Kallikrein 8 (KLK8) (NM_144506) Human Untagged Clone
CAT#: SC306152
KLK8 (untagged)-Human kallikrein-related peptidase 8 (KLK8), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HNP; NP; NRPN; PRSS19; TADG14 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_144506, the custom clone sequence may differ by one or more nucleotides
ATGGGACGCCCCCGACCTCGTGCGGCCAAGACGTGGATGTTCCTGCTCTTGCTGGGGGGA GCCTGGGCAGAGAATTTTCCTGACACTCTCAACTGTGCAGAAGTAAAAATCTTTCCCCAG AAGAAGTGTGAGGATGCTTACCCGGGGCAGATCACAGATGGCATGGTCTGTGCAGGCAGC AGCAAAGGGGCTGACACGTGCCAGGGCGATTCTGGAGGCCCCCTGGTGTGTGATGGTGCA CTCCAGGGCATCACATCCTGGGGCTCAGACCCCTGTGGGAGGTCCGACAAACCTGGCGTC TATACCAACATCTGCCGCTACCTGGACTGGATCAAGAAGATCATAGGCAGCAAGGGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_144506 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_144506.1, NP_653089.1 |
RefSeq Size | 590 bp |
RefSeq ORF | 360 bp |
Locus ID | 11202 |
UniProt ID | O60259 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in tandem in a gene cluster on chromosome 19. The encoded protein may be involved in proteolytic cascade in the skin and may serve as a biomarker for ovarian cancer. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (3, also known as T3) lacks two alternate exons in the coding region, compared to variant 2. It encodes isoform 3, which lacks an in-frame segment and is shorter than isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221052 | KLK8 (Myc-DDK-tagged)-Human kallikrein-related peptidase 8 (KLK8), transcript variant 3 |
CNY 3,990.00 |
|
RC221052L3 | Lenti-ORF clone of KLK8 (Myc-DDK-tagged)-Human kallikrein-related peptidase 8 (KLK8), transcript variant 3 |
CNY 5,890.00 |
|
RC221052L4 | Lenti-ORF clone of KLK8 (mGFP-tagged)-Human kallikrein-related peptidase 8 (KLK8), transcript variant 3 |
CNY 5,890.00 |
|
RG221052 | KLK8 (tGFP-tagged) - Human kallikrein-related peptidase 8 (KLK8), transcript variant 3 |
CNY 4,370.00 |