United States
Germany
Japan
United Kingdom
China
Kallikrein 15 (KLK15) (NM_138564) Human Untagged Clone
CAT＃: SC306039
KLK15 (untagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACO; HSRNASPH |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_138564, the custom clone sequence may differ by one or more nucleotides
ATGTGGCTTCTCCTCACTCTCTCCTTCCTGCTGGCATCCACAGCAGCCCAGGATGGTGAC AAGTTGCTGGAAGGTGACGAGTGTGCACCCCACTCCCAGCCATGGCAAGTGGCTCTCTAC GAGCGTGGACGCTTTAACTGTGGCGCTTCCCTCATCTCCCCACACTGGGTGCTGTCTGCG GCCCACTGCCAAAGCCGCTTCATGAGAGTGCGCCTGGGAGAGCACAACCTGCGCAAGCGC GATGGCCCAGAGCAACTACGGACCACGTCTCGGGTCATTCCACACCCGCGCTACGAAGCG CGCAGCCACCGCAACGACATCATGTTGCTGCGCCTAGTCCAGCCCGCACGCCTGAACCCC CAGGGTGACTCTGGGGGACCCCTGGTCTGTGGGGGCATCCTGCAGGGCATTGTGTCCTGG GGTGACGTCCCTTGTGACAACACCACCAAGCCTGGTGTCTATACCAAAGTCTGCCACTAC TTGGAGTGGATCAGGGAAACCATGAAGAGGAACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_138564 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138564.1, NP_612631.1 |
| RefSeq Size | 1054 bp |
| RefSeq ORF | 516 bp |
| Locus ID | 55554 |
| Protein Families | Druggable Genome, Protease, Secreted Protein |
| Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate splice site on an internal exon and lacks an alternate exon, compared to variant 4. The missing internal segment results in an encoded isoform (3) that lacks an internal region, but shares the same N- and C-termini, compared to isoform 4. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213756 | KLK15 (Myc-DDK-tagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 |
CNY 2,400.00 |
|
| RC213756L3 | Lenti-ORF clone of KLK15 (Myc-DDK-tagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 |
CNY 5,890.00 |
|
| RC213756L4 | Lenti-ORF clone of KLK15 (mGFP-tagged)-Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 |
CNY 5,890.00 |
|
| RG213756 | KLK15 (tGFP-tagged) - Human kallikrein-related peptidase 15 (KLK15), transcript variant 3 |
CNY 4,370.00 |
其它Kallikrein 15产品
