MPIG6B (NM_138274) Human Untagged Clone

CAT#: SC305993

C6orf25 (untagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 4



  "NM_138274" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-C6orf25 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf25; G6b; G6b-B; NG31; THAMY
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305993 representing NM_138274.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGTGTTTCTGCAGCTGCTACCGCTGCTGCTCTCGAGGGCCCAAGGGAACCCTGGGGCTTCTCTG
GACGGCCGCCCTGGGGACCGGGTGAATCTCTCCTGCGGAGGAGTCTCTCATCCCATCCGCTGGGTCTGG
GCACCCAGCTTCCCGGCCTGCAAGGGCCTGTCCAAAGGACGCCGACCGATCCTGTGGGCCTCTTCGAGC
GGGACCCCCACCGTGCCTCCCCTCCAGCCTTTCGTCGGCCGCCTACGCTCCCTGGACTCTGGTATCCGG
CGGCTGGAGCTCCTCTTGAGCGCGGGGGACTCGGGCACTTTTTTCTGCAAGGGCCGCCACGAGGACGAG
AGCCGTACAGTGCTTCACGTGCTGGGGGACAGGACCTATTGCAAGGCCCCCGGGCCTACCCATGCTCTG
TCCCCCCCACATAGCTCCACTTGTGAAAACCGAGCCCCAGAGGCCAGTAAAGGAGGAAGAGCCCAAGAT
TCCAGGGGACCTGGACCAGGAACCGAGCCTGCTCTATGCGGATCTGGACCATCTAGCCCTCAGCAGGCC
CCGCCGGCTGTCCACAGCGGACCCTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_138274
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138274.2
RefSeq Size 2303 bp
RefSeq ORF 582 bp
Locus ID 80739
UniProt ID O95866
Protein Families Druggable Genome, Transmembrane
MW 20.2 kDa
Gene Summary This gene is a member of the immunoglobulin (Ig) superfamily and is located in the major histocompatibility complex (MHC) class III region. The protein encoded by this gene is a glycosylated, plasma membrane-bound cell surface receptor, but soluble isoforms encoded by some transcript variants have been found in the endoplasmic reticulum and Golgi before being secreted. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks coding exons 3 and 4 as compared to transcript variant 1. As a result, variant 4 encodes an isoform (G6b-D), which has the same N- and C-termini, but lacks an internal 44 aa region as compared to isoform G6b-A. Isoform G6b-D is a soluble, secreted protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...