MPIG6B (NM_138274) Human Untagged Clone
CAT#: SC305993
C6orf25 (untagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C6orf25; G6b; G6b-B; NG31; THAMY |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305993 representing NM_138274.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGTGTTTCTGCAGCTGCTACCGCTGCTGCTCTCGAGGGCCCAAGGGAACCCTGGGGCTTCTCTG GACGGCCGCCCTGGGGACCGGGTGAATCTCTCCTGCGGAGGAGTCTCTCATCCCATCCGCTGGGTCTGG GCACCCAGCTTCCCGGCCTGCAAGGGCCTGTCCAAAGGACGCCGACCGATCCTGTGGGCCTCTTCGAGC GGGACCCCCACCGTGCCTCCCCTCCAGCCTTTCGTCGGCCGCCTACGCTCCCTGGACTCTGGTATCCGG CGGCTGGAGCTCCTCTTGAGCGCGGGGGACTCGGGCACTTTTTTCTGCAAGGGCCGCCACGAGGACGAG AGCCGTACAGTGCTTCACGTGCTGGGGGACAGGACCTATTGCAAGGCCCCCGGGCCTACCCATGCTCTG TCCCCCCCACATAGCTCCACTTGTGAAAACCGAGCCCCAGAGGCCAGTAAAGGAGGAAGAGCCCAAGAT TCCAGGGGACCTGGACCAGGAACCGAGCCTGCTCTATGCGGATCTGGACCATCTAGCCCTCAGCAGGCC CCGCCGGCTGTCCACAGCGGACCCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_138274 |
Insert Size | 582 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138274.2 |
RefSeq Size | 2303 bp |
RefSeq ORF | 582 bp |
Locus ID | 80739 |
UniProt ID | O95866 |
Protein Families | Druggable Genome, Transmembrane |
MW | 20.2 kDa |
Gene Summary | This gene is a member of the immunoglobulin (Ig) superfamily and is located in the major histocompatibility complex (MHC) class III region. The protein encoded by this gene is a glycosylated, plasma membrane-bound cell surface receptor, but soluble isoforms encoded by some transcript variants have been found in the endoplasmic reticulum and Golgi before being secreted. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) lacks coding exons 3 and 4 as compared to transcript variant 1. As a result, variant 4 encodes an isoform (G6b-D), which has the same N- and C-termini, but lacks an internal 44 aa region as compared to isoform G6b-A. Isoform G6b-D is a soluble, secreted protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215589 | C6orf25 (Myc-DDK-tagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 4 |
CNY 2,400.00 |
|
RC215589L3 | Lenti ORF clone of Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215589L4 | Lenti ORF clone of Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG215589 | C6orf25 (tGFP-tagged) - Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 4 |
CNY 4,370.00 |