MPIG6B (NM_138273) Human Untagged Clone
CAT#: SC305992
C6orf25 (untagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C6orf25; G6b; G6b-B; NG31; THAMY |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_138273, the custom clone sequence may differ by one or more nucleotides
ATGGCTGTGTTTCTGCAGCTGCTACCGCTGCTGCTCTCGAGGGCCCAAGGGAACCCTGGG GCTTCTCTGGACGGCCGCCCTGGGGACCGGGTGAATCTCTCCTGCGGAGGAGTCTCTCAT CCCATCCGCTGGGTCTGGGCACCCAGCTTCCCGGCCTGCAAGGGCCTGTCCAAAGGACGC CGACCGATCCTGTGGGCCTCTTCGAGCGGGACCCCCACCGTGCCTCCCCTCCAGCCTTTC GTCGGCCGCCTACGCTCCCTGGACTCTGGTATCCGGCGGCTGGAGCTCCTCTTGAGCGCG GGAGACTCGGGCACTTTTTTCTGCAAGGGCCGCCACGAGGACGAGAGCCGTACAGTGCTT CACGTGCTGGGGGACAGGACCTATTGCAAGGCCCCCGGGCCTACCCATGGCGCCTGCCCC CGCAACCGATTCGACCACTCCCTAGATTTGCTCTGTCCCCCCCACATAGCTCCACTTGTG AAAACCGAGCCCCAGAGGCCAGTAAAGGAGGAAGAGCCCAAGATTCCAGGGGACCTGGAC CAGGAACCGAGCCTGCTCTATGCGGATCTGGACCATCTAGCCCTCAGCAGGCCCCGCCGG CTGTCCACAGCGGACCCTGCTGATGCCTCCACCATCTATGCAGTTGTAGTTTGA |
Restriction Sites | Please inquire |
ACCN | NM_138273 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138273.1, NP_612117.1 |
RefSeq Size | 654 bp |
RefSeq ORF | 654 bp |
Locus ID | 80739 |
UniProt ID | O95866 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene is a member of the immunoglobulin (Ig) superfamily and is located in the major histocompatibility complex (MHC) class III region. The protein encoded by this gene is a glycosylated, plasma membrane-bound cell surface receptor, but soluble isoforms encoded by some transcript variants have been found in the endoplasmic reticulum and Golgi before being secreted. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks coding exon 3 as compared to transcript variant 1. As a result, variant 3 encodes an isoform (G6b-C), which has a different C-terminus than isoform G6b-A. Isoform G6b-C is a soluble, secreted protein containing 2 immunoreceptor tyrosine-based inhibitory motifs (ITIM). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222335 | C6orf25 (Myc-DDK-tagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 3 |
CNY 3,840.00 |
|
RC222335L3 | Lenti-ORF clone of C6orf25 (Myc-DDK-tagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 3 |
CNY 5,890.00 |
|
RC222335L4 | Lenti-ORF clone of C6orf25 (mGFP-tagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 3 |
CNY 5,890.00 |
|
RG222335 | C6orf25 (tGFP-tagged) - Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 3 |
CNY 4,370.00 |