S100Z (NM_130772) Human Untagged Clone
CAT#: SC305901
S100Z (untagged)-Human S100 calcium binding protein Z (S100Z)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Gm625; S100-zeta |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305901 representing NM_130772.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCACCCAGCTCGAGATGGCCATGGACACCATGATTAGAATCTTCCACCGCTATTCTGGCAAGGAA AGGAAGAGATTCAAGCTCAGCAAGGGGGAACTGAAACTGCTCCTGCAGCGAGAGCTCACGGAATTCCTC TCGTGCCAAAAGGAAACCCAGTTGGTTGATAAGATAGTGCAGGACCTGGATGCCAATAAGGACAACGAA GTGGATTTTAATGAATTCGTGGTCATGGTGGCAGCTCTGACAGTTGCTTGTAATGATTACTTTGTAGAA CAATTGAAGAAGAAAGGAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_130772 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_130772.3 |
RefSeq Size | 1164 bp |
RefSeq ORF | 300 bp |
Locus ID | 170591 |
UniProt ID | Q8WXG8 |
MW | 11.6 kDa |
Gene Summary | Members of the S100 protein family contain 2 calcium-binding EF-hands and exhibit cell-type specific expression patterns. For additional background information on S100 proteins, see MIM 114085.[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204754 | S100Z (Myc-DDK-tagged)-Human S100 calcium binding protein Z (S100Z) |
CNY 1,200.00 |
|
RC204754L1 | Lenti ORF clone of Human S100 calcium binding protein Z (S100Z), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC204754L2 | Lenti ORF clone of Human S100 calcium binding protein Z (S100Z), mGFP tagged |
CNY 5,890.00 |
|
RC204754L3 | Lenti ORF clone of Human S100 calcium binding protein Z (S100Z), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204754L4 | Lenti ORF clone of Human S100 calcium binding protein Z (S100Z), mGFP tagged |
CNY 5,890.00 |
|
RG204754 | S100Z (tGFP-tagged) - Human S100 calcium binding protein Z (S100Z) |
CNY 2,800.00 |
|
SC321094 | S100Z (untagged)-Human S100 calcium binding protein Z (S100Z) |
CNY 1,200.00 |