WFDC10A (NM_080753) Human Untagged Clone
CAT#: SC305831
WFDC10A (untagged)-Human WAP four-disulfide core domain 10A (WFDC10A)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf146; dJ688G8.3; WAP10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305831 representing NM_080753.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCACCCCAGACTCTGCTGCCTGTCCTGGTTCTCTGTGTGCTGCTGCTGCAGGCCCAGGGAGGATAC CGTGACAAGAAGAGGATGCAGAAAACACAGCTATCCCCAGAAATCAAAGTCTGCCAGCAGCAGCCTAAA CTATATCTATGCAAACACTTATGTGAATCTCACCGAGATTGTCAAGCAAATAACATATGCTGTTCTACC TACTGTGGGAATGTTTGCATGAGCATCCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_080753 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_080753.2 |
RefSeq Size | 482 bp |
RefSeq ORF | 240 bp |
Locus ID | 140832 |
UniProt ID | Q9H1F0 |
Protein Families | Secreted Protein, Transmembrane |
MW | 8.9 kDa |
Gene Summary | This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212400 | WFDC10A (Myc-DDK-tagged)-Human WAP four-disulfide core domain 10A (WFDC10A) |
CNY 1,200.00 |
|
RC212400L3 | Lenti ORF clone of Human WAP four-disulfide core domain 10A (WFDC10A), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212400L4 | Lenti ORF clone of Human WAP four-disulfide core domain 10A (WFDC10A), mGFP tagged |
CNY 5,890.00 |
|
RG212400 | WFDC10A (tGFP-tagged) - Human WAP four-disulfide core domain 10A (WFDC10A) |
CNY 2,800.00 |
其它WFDC10A产品