p16INK4A (CDKN2A) (NM_058195) Human Untagged Clone
CAT#: SC305765
CDKN2A (untagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARF; CDK4I; CDKN2; CMM2; INK4; INK4A; MLM; MTS-1; MTS1; P14; P14ARF; P16; P16-INK4A; P16INK4; P16INK4A; P19; P19ARF; TP16 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_058195 edited
ATGGGCAGGGGGCGGTGCGTGGGTCCCAGTCTGCAGTTAAGGGGGCAGGAGTGGCGCTGC TCACCTCTGGTGCCAAAGGGCGGCGCAGCGGCTGCCGAGCTCGGCCCTGGAGGCGGCGAG AACATGGTGCGCAGGTTCTTGGTGACCCTCCGGATTCGGCGCGCGTGCGGCCCGCCGCGA GTGAGGGTTTTCGTGGTTCACATCCCGCGGCTCACGGGGGAGTGGGCAGCGCCAGGGGCG CCCGCCGCTGTGGCCCTCGTGCTGATGCTACTGAGGAGCCAGCGTCTAGGGCAGCAGCCG CTTCCTAGAAGACCAGGTCATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCT CCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGC TGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGA CGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGA TGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGTAACCATGCCCGCAT AGATGCCGCGGAAGGTCCCTCAGACATCCCCGATTGAAAGAACCAGAGAGGCTCTGAGAA ACCTCCGGAAACTTAGATCATCAGTCACCGAAGGTCCTACAGGGCCACAACTGCCCCCGC CACAACCCACCCCGCTTTCGTAGTTTTCATTTAGAAAATAGAGCTTTTAAAAATGTCCTG CCTTTTAACGTAGATATATGCCTTCCCCCACTACCGTAAATGTCCATTTATATCATTTTT TATATATTCTTATAAAAATGTAAAAAAGAAAAAAAAAAAAAAAAAAAAAAA >OriGene 5' read for NM_058195 unedited
GTTCACATTTGTATACGACTCATATAGGCGGCCGCGATTCTGGGCAGGGGGCGGTGCGTG GGTCCCAGTCTGCAGTTAAGGGGGCAGGAGTGGCGCTGCTCACCTCTGGTGCCAAAGGGC GGCGCAGCGGCTGCCGAGCTCGGCCCTGGAGGCGGCGAGAACATGGTGCGCAGGTTCTTG GTGACCCTCCGGATTCGGCGCGCGTGCGGCCCGCCGCGAGTGAGGGTTTTCGTGGTTCAC ATCCCGCGGCTCACGGGGGAGTGGGCAGCGCCAGGGGCGCCCGCCGCTGTGGCCCTCGTG CTGATGCTACTGAGGAGCCAGCGTCTAGGGCAGCAGCCGCTTCCTAGAAGACCAGGTCAT GATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTG CGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGA CACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCG TCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGC GGCTGCGGGGGGCACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTC AGACATCCCCGATTGAAAGAACCAGAGAGGCTCTGAGAAACCTCCGGAAACTTAGATCAT CAGTCACCGAAGGTCCTACAGGGCCACAACTGCCCCCGCCACAACCCACCCCGCTTTCGT AGTTTTCATTTAAGAAAATAGAGCTTTTAAAAATGTCCTGGCCTTTTAC |
Restriction Sites | Please inquire |
ACCN | NM_058195 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_058195.2, NP_478102.1 |
RefSeq Size | 1154 bp |
RefSeq ORF | 522 bp |
Locus ID | 1029 |
UniProt ID | Q8N726 |
Protein Families | Druggable Genome |
Protein Pathways | Bladder cancer, Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer |
Gene Summary | This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012] Transcript Variant: This variant (4), also known as beta, encodes p14ARF. Transcripts 1 and 4, encoding p16INK4a and p14ARF have distinct first exons which contain the translation start codon, and share a common second exon, which is translated in different reading frames. Thus, the p14ARF protein encoded by this variant (4) lacks sequence similarity to the protein product of variant 1 (p16INK4a). Note that this variant may use an alternative upstream start codon, which would produce an isoform that is 41 aa longer at the N-terminus, or an alternative downstream start codon, which would produce an isoform (smARF, described in PMID:16713577) that is 47 aa shorter at the N-terminus; it is unclear if the isoforms derived from the alternative start codons are present in vivo. The p14ARF protein is known to be nucleoplasmic but may also be recruited to mitochondria, as described in PMID:20107316. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211784 | CDKN2A (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4 |
CNY 2,400.00 |
|
RC211784L1 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211784L2 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RC211784L3 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211784L4 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4, mGFP tagged |
CNY 4,800.00 |
|
RG211784 | CDKN2A (tGFP-tagged) - Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 4 |
CNY 4,370.00 |
其它p16INK4A产品