GNG2 (NM_053064) Human Untagged Clone

CAT#: SC305721

GNG2 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 2 (GNG2)



  "NM_053064" in other vectors (6)

CNY 1,800.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-GNG2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_053064 edited
ATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAG
ATGGAAGCCAATATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTAC
TGTGAAGCACATGCCAAGGAAGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCG
TTTAGGGAGAAGAAGTTTTTCTGTGCCATCCTTTAA
>OriGene 5' read for NM_053064 unedited
TTAGGAACTGAAGAGTGTTTCTGAAAGATCTATCCAGCACTCCGATGGCCAGCAACAACA
CCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAGATGGAAGCCAATATCG
ACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTACTGTGAAGCACATGCCA
AGGAAGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCGTTTAGGGAGAAGAAGT
TTTTCTGTGCCATCCTTTAAGTCTTTGAGAGGGGCCTGAAGAGCCTCCGGGCTCCTGGGA
CATTGATGTAGAGTTTTTAGTGAAGTGGGCACCTTTCTAGTCCACGGCATTTGAAGAGAG
CGAGGAGAACCATTCTGGAAACTCTAGGCTATGCATGTTTAAAGATCTGGTCCCCTTTAT
GAGAATGCAAGCCGATCCACATCCTGACTTAAGAGATCTGATTCTGACGAACTGCCTGGA
GGAGGGGAATATATAAAAATAAAATTGGTGTCACTTCTTTTCTGCTATCCCCCAGCCCCC
CCCCCAAAATCCTCATGTTTCTGCTTCATATTTTGAAAAATAACAATTAAAACAGACAGC
TGTACTGAGGTAAGATATGTGTGACCTTCTTGGATGAATATTGTCTTTAGAATACCCTTT
GATAGCTGAGCTGTCCCGTGTAATGCANTNCNNGTTAATGCATTGAGTATAGNCACTGTG
CTTTCTTTTTTTNTTNCTTTNNCTTACCCTNCTTTCACCCCTCCATANAGTATGTGAGAT
AAGCTGGACTGTCTATCAGATGACTCCAGAA
Restriction Sites NotI-NotI     
ACCN NM_053064
Insert Size 3000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_053064.2, NP_444292.1
RefSeq Size 3460 bp
RefSeq ORF 216 bp
Locus ID 54331
UniProt ID P59768
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Gene Summary This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...