Tumor protein D52 like 3 (TPD52L3) (NM_033516) Human Untagged Clone

CAT#: SC305653

TPD52L3 (untagged)-Human tumor protein D52-like 3 (TPD52L3), transcript variant 1



  "NM_033516" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TPD52L3 (Tumor protein D52 like 3) mouse monoclonal antibody, clone OTI8C12 (formerly 8C12)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D55; hD55; NYDSP25; TPD55
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_033516 edited
ACAGGCCAGGTCGTCAACTCAACTGTCAAGGTGTCCATTGTACCAGCTGGGCCATGGATC
CCTCCCGCCTGAAATCTGACTCCACCTGCCAAGAGTCTGAGCCTGCAGGCCTAGATTTCG
ACTCTGCTGGCCAAGATTATTTCTCTGCAGCCCAATAATTCGACTCTTTCTACCAAGAAT
TGGACCTGGACTCTCTTAACGAAGATCTTCTTTCCCAGTCCATGCCACATGCCAGGACAG
AGACCTCTGTGGGCACATATGAATCCCACTCGACTTCTGAACTGGAGGATCTGACAGAGC
CCGAGCAAAGAGAGCTCAAAACCAAACTCACTAAATTGGAGGCTGAAATTGTAACCCTAC
GCCACGTACTAGCAGCCAAAGAGAGACGCTGTGGGGAACTCAAGAGGAAGTTAGGCCTCA
CCGCCTTGGTAGGGCTGAGACAGAATCTGTCCAAGAGCTGGCTTGATGTTCAGGTCTCCA
ACACCTATGTGAAACAGAAGACATCAGCTGCTCTGTCCACCATGGGCACTCTCATCTGCA
GGAAGCTTGGAGGCGTGAAGAAGTCGGCCACACTCAGATCTTTTGAAGGTCTGATGGGGA
CAATCAAGTCCAAAGTCTCA:GGGGCAAAAGAGCTTGGCCCTGA
Restriction Sites Please inquire     
ACCN NM_033516
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033516.4.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033516.4, NP_277051.3
RefSeq Size 2298 bp
RefSeq ORF 423 bp
Locus ID 89882
UniProt ID Q96J77
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the tumor protein D52-like family of proteins. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. The encoded protein may play a role in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...