United States
Germany
Japan
United Kingdom
China
B3GALT5 (NM_033171) Human Untagged Clone
CAT＃: SC305585
B3GALT5 (untagged)-Human UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 (B3GALT5), transcript variant 3
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 3-GalTase 5; B3GalT-V; B3GalTx; B3T5; beta-1; beta-3-Gx-T5; beta3Gal-T5; GLCT5 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_033171, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTCCCGAAGATGAGATTGATGTATATTTGCCTTCTGGTTCTGGGGGCTCTTTGT TTGTATTTTAGCATGTACAGTCTAAATCCTTTCAAAGAACAGTCCTTTGTTTACAAGAAA GACGGGAACTTCCTTAAGCTCCCAGATACAGACTGCAGGCAGACACCTCCCTTCCTCGTC CTGCTGGTGACCTCATCCCACAAACAGTTGGCTGAGCGCATGGCCATCCGGCAGACGTGG GGGAAAGAGAGGATGGTGAAGGGAAAGCAGCTGAAGACATTCTTCCTCCTGGGGACCACC AGCAGTGCAGCGGAAACGAAAGAGGTGGACCAGGAGAGCCAGCGACACGGGGACATTATC CAGAAGGATTTCCTAGACGTCTATTACAATCTGACCCTGAAGACCATGATGGGCATAGAA TGGGTCCATCGCTTTTGTCCTCAGGCGGCGTTTGTGATGAAAACAGACTCAGACATGTTC ATCAATGTTGACTATCTGACTGAACTGCTTCTGAAGAAAAACAGAACAACCAGGTTTTTC ACTGGCTTCTTGAAACTCAATGAGTTTCCCATCAGGCAGCCATTCAGCAAGTGGTTTGTC AGTAAATCTGAATATCCGTGGGACAGGTACCCACCATTCTGCTCCGGCACCGGCTACGTG TTTTCTGGCGACGTGGCGAGTCAGGTGTACAATGTCTCCAAGAGCGTCCCATACATTAAA CTGGAAGACGTGTTTGTGGGGCTCTGCCTCGAAAGGCTGAACATCAGATTGGAGGAGCTC CACTCCCAGCCGACCTTTTTTCCAGGGGGCTTACGCTTCTCCGTATGCCTCTTCAGGAGG ATCGTGGCCTGCCACTTCATCAAGCCTCGGACTCTCTTGGACTACTGGCAGGCTCTAGAG AATTCCCGGGGGGAAGATTGTCCGCCTGTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_033171 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033171.1, NP_149361.1 |
| RefSeq Size | 2871 bp |
| RefSeq ORF | 933 bp |
| Locus ID | 10317 |
| UniProt ID | Q9Y2C3 |
| Protein Families | Transmembrane |
| Protein Pathways | Glycosphingolipid biosynthesis - globo series, Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways |
| Gene Summary | This gene encodes a member of a family of membrane-bound glycoproteins. The encoded protein may synthesize type 1 Lewis antigens, which are elevated in gastrointestinal and pancreatic cancers. Alternatively spliced transcript variants using multiple alternate promoters have been observed for this gene. [provided by RefSeq, Sep 2017] Transcript Variant: This variant (3) represents use of a promoter derived from long terminal repeat (LTR) and contains an alternate exon in the 5' UTR, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214721 | B3GALT5 (Myc-DDK-tagged)-Human UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 (B3GALT5), transcript variant 3 |
CNY 2,400.00 |
|
| RC214721L3 | Lenti-ORF clone of B3GALT5 (Myc-DDK-tagged)-Human UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 (B3GALT5), transcript variant 3 |
CNY 5,890.00 |
|
| RC214721L4 | Lenti-ORF clone of B3GALT5 (mGFP-tagged)-Human UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 (B3GALT5), transcript variant 3 |
CNY 5,890.00 |
|
| RG214721 | B3GALT5 (tGFP-tagged) - Human UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 (B3GALT5), transcript variant 3 |
CNY 4,370.00 |
其它B3GALT5产品
