ZDH12 (ZDHHC12) (NM_032799) Human Untagged Clone

CAT#: SC305502

ZDHHC12 (untagged)-Human zinc finger, DHHC-type containing 12 (ZDHHC12)



  "NM_032799" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ZDHHC12 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DHHC-12; ZNF400
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305502 representing NM_032799.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCCCTGGGCGCTCCTCAGCCCTGGGGTCCTGGTGCGGACCGGGCACACCGTGCTGACCTGGGGA
ATCACGCTGGTGCTCTTCCTGCACGATACCGAGCTGCGGCAATGGGAGGAGCAGGGGGAGCTGCTCCTG
CCCCTCACCTTCCTGCTCCTGGTGCTGGGCTCCCTGCTGCTCTACCTCGCTGTGTCACTCATGGACCCT
GGCTACGTGAATGTGCAGCCCCAGCCTCAGGAGGAGCTCAAAGAGGAGCAGACAGCCATGGTTCCTCCA
GCCATCCCTCTTCGGCGCTGCAGATACTGCCTGGTGCTGCAGCCCCTGAGGGCTCGGCACTGCCGTGAG
TGCCGCCGTTGCGTCCGCCGCTACGACCACCACTGCCCCTGGATGGAGAACTGTGTGGGAGAGCGCAAC
CACCCACTCTTTGTGGTCTACCTGGCGCTGCAGCTGGTGGTGCTTCTGTGGGGCCTGTACCTGGCATGG
TCAGGCCTCCGGTTCTTCCAGCCCTGGGGTCTGTGGTTGCGGTCCAGCGGGCTCCTGTTCGCCACCTTC
CTGCTGCTGTCCCTCTTCTCGTTGGTGGCCAGCCTGCTCCTCGTCTCGCACCTCTACCTGGTGGCCAGC
AACACCACCACCTGGGAATTCATCTCCTCACACCGCATCGCCTATCTCCGCCAGCGCCCCAGCAACCCC
TTCGACCGAGGCCTGACCCGCAACCTGGCCCACTTCTTCTGTGGATGGCCCTCAGGGTCCTGGGAGACC
CTCTGGGCTGAGGAGGAGGAAGAGGGCAGCAGCCCAGCTGTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_032799
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032799.4
RefSeq Size 1184 bp
RefSeq ORF 804 bp
Locus ID 84885
UniProt ID Q96GR4
Protein Families Transmembrane
MW 30.8 kDa
Gene Summary Palmitoyltransferase that could catalyze the addition of palmitate onto various protein substrates. Has a palmitoyltransferase activity toward gephyrin/GPHN, regulating its clustering at synapses and its function in gamma-aminobutyric acid receptor clustering. Thereby, indirectly regulates GABAergic synaptic transmission.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) uses an alternate splice site in the 5' coding region, compared to variant 1. It encodes isoform 5 which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...