United States
Germany
Japan
United Kingdom
China
SPANXD (NM_032417) Human Untagged Clone
CAT＃: SC305442
SPANXD (untagged)-Human SPANX family, member D (SPANXD)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT11.3; CT11.4; dJ171K16.1; SPANX-C; SPANX-D; SPANX-E; SPANXC; SPANXE |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_032417, the custom clone sequence may differ by one or more nucleotides
ATGGACAAACAATCCAGTGCCGGCGGGGTGAAGAGGAGCGTCCCCTGTGATTCCAACGAGGCCAACGAGA TGATGCCGGAGACCTCGAGTGGGTACTCAGACCCGCAACCTGCTCCGAAAAAACTAAAAACATCTGAGTC CTCGACCATACTAGTGGTTCGCTACAGGAGGAACTTTAAAAGAACATCTCCAGAGGAACTGGTGAATGAC CACGCCCGAAAGAACAGAATCAACCCCCTCCAAATGGAGGAGGAGGAATTCATGGAAATAATGGTTGAAA TACCTGCAAAGTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_032417 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | It was fully sequenced and the DNA sequence matches with that of NM_032417.2.There are a few SNPs in ORF. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_032417.2, NP_115793.1 |
| RefSeq Size | 384 bp |
| RefSeq ORF | 294 bp |
| Locus ID | 64648 |
| UniProt ID | Q9BXN6 |
| Gene Summary | Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a sperm protein that is associated with the nucleus but, although a role in spermatogenesis is suggested, the specific function of this family member has not yet been determined. Polymorphisms in this gene may be associated with prostate cancer susceptibility. [provided by RefSeq, Apr 2014] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221316 | SPANXD (Myc-DDK-tagged)-Human SPANX family, member D (SPANXD) |
CNY 3,990.00 |
|
| RC221316L3 | Lenti-ORF clone of SPANXD (Myc-DDK-tagged)-Human SPANX family, member D (SPANXD) |
CNY 5,890.00 |
|
| RC221316L4 | Lenti-ORF clone of SPANXD (mGFP-tagged)-Human SPANX family, member D (SPANXD) |
CNY 5,890.00 |
|
| RG221316 | SPANXD (tGFP-tagged) - Human SPANX family, member D (SPANXD) |
CNY 4,370.00 |
