KRTAP3-1 (NM_031958) Human Untagged Clone
CAT#: SC305378
KRTAP3 (untagged)-Human keratin associated protein 3-1 (KRTAP3-1)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KAP3.1; KRTAP3.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305378 representing NM_031958.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTATTGCTGTGCTCTCCGCTCCTGCAGCGTCCCCACCGGCCCTGCCACCACCTTCTGCTCATTTGAT AAAAGCTGCCGCTGTGGAGTCTGCCTACCCAGCACCTGCCCACATGAGATCAGCCTCCTTCAGCCCATC TGCTGTGACACCTGCCCCCCACCCTGCTGCAAGCCTGATACCTATGTGCCAACTTGCTGGCTGCTCAAC AACTGTCACCCGACTCCCGGACTGAGTGGGATCAACCTGACCACCTATGTTCAGCCTGGCTGTGAGAGT CCCTGTGAGCCCCGCTGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_031958 |
Insert Size | 297 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_031958.1 |
RefSeq Size | 614 bp |
RefSeq ORF | 297 bp |
Locus ID | 83896 |
UniProt ID | Q9BYR8 |
MW | 10.5 kDa |
Gene Summary | This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211851 | KRTAP3 (Myc-DDK-tagged)-Human keratin associated protein 3-1 (KRTAP3-1) |
CNY 1,200.00 |
|
RC211851L3 | Lenti ORF clone of Human keratin associated protein 3-1 (KRTAP3-1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211851L4 | Lenti ORF clone of Human keratin associated protein 3-1 (KRTAP3-1), mGFP tagged |
CNY 5,890.00 |
|
RG211851 | KRTAP3 (tGFP-tagged) - Human keratin associated protein 3-1 (KRTAP3-1) |
CNY 2,800.00 |
其它KRTAP3-1产品