CHP2 (NM_022097) Human Untagged Clone

CAT#: SC304990

CHP2 (untagged)-Human calcineurin B homologous protein 2 (CHP2)



  "NM_022097" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-CHP2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304990 representing NM_022097.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGTCGCGCAGCTCCCACGCCGCGGTCATTCCCGACGGGGACAGTATTCGGCGAGAGACCGGCTTC
TCCCAAGCCAGCCTGCTCCGCCTGCACCACCGGTTCCGGGCACTGGACAGGAATAAGAAGGGCTACCTG
AGCCGCATGGATCTCCAGCAGATAGGGGCGCTCGCCGTGAACCCCCTGGGAGACCGAATTATAGAAAGC
TTCTTCCCCGATGGGAGCCAGCGAGTGGATTTCCCAGGCTTTGTCAGGGTCTTGGCTCATTTTCGCCCT
GTAGAAGATGAGGACACAGAAACCCAAGACCCCAAGAAACCTGAACCTCTCAACAGCAGAAGGAACAAA
CTTCACTATGCATTTCAGCTCTATGACCTGGATCGCGATGGGAAGATCTCCAGGCATGAGATGCTGCAG
GTTCTCCGTCTGATGGTTGGGGTACAGGTGACAGAAGAGCAGCTGGAGAACATCGCTGACCGCACGGTG
CAGGAGGCTGATGAAGATGGGGATGGGGCTGTGTCCTTCGTGGAGTTCACCAAGTCCTTAGAGAAGATG
GACGTTGAGCAAAAAATGAGCATCCGGATCCTGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_022097
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022097.3
RefSeq Size 2389 bp
RefSeq ORF 591 bp
Locus ID 63928
UniProt ID O43745
Protein Pathways Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Apoptosis, Axon guidance, B cell receptor signaling pathway, Calcium signaling pathway, Long-term potentiation, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Oocyte meiosis, T cell receptor signaling pathway, VEGF signaling pathway, Wnt signaling pathway
MW 22.5 kDa
Gene Summary This gene product is a small calcium-binding protein that regulates cell pH by controlling plasma membrane-type Na+/H+ exchange activity. This protein shares sequence similarity with calcineurin B and can bind to and stimulate the protein phosphatase activity of calcineurin A (CnA) and functions in the calcineurin/NFAT (nuclear factor of activated T cells) signaling pathway. Another member of the CHP subfamily, Calcineurin B homologous protein 1, is located on Chromosome 15 and is an inhibitor of calcineurin activity and has a genetic phenotype associated with Parkinson's Disease (OMIM:606988). This gene was initially identified as a tumor-associated antigen and was previously referred to as Hepatocellular carcinoma-associated antigen 520. [provided by RefSeq, Jul 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...