CD79B (NM_021602) Human Untagged Clone

CAT#: SC304941

CD79B (untagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 2



  "NM_021602" in other vectors (4)

CNY 3,990.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
CD79B mouse monoclonal antibody,clone OTI8A12
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGM6; B29; IGB
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_021602 edited
CAGAGCGGTGACCATGGCCAGGCTGGCGTTGTCTCCTGTGCCCAGCCACTGGATGGTGGC
GTTGCTGCTGCTGCTCTCAGCTGAGCCAGTACCAGCAGCCAGATCGGAGGACCGGTACCG
GAATCCCAAAGGATTCAGCACCTTGGCACAGCTGAAGCAGAGGAACACGCTGAAGGATGG
TATCATCATGATCCAGACGCTGCTGATCATCCTCTTCATCATCGTGCCTATCTTCCTGCT
GCTGGACAAGGATGACAGCAAGGCTGGCATGGAGGAAGATCACACCTACGAGGGCCTGGA
CATTGACCAGACAGCCACCTATGAGGACATAGTGACGCTGCGGACAGGGGAAGTGAAGTG
GTCTGTAGGTGAGCACCCAGGCCAGGAGTGAGAGCCAGGTCGCCCCATGACCTGGGTGCA
GGCTCCCTGGCCTCAGTGACTGCTTCGGAGCTGCCTGGCTCATGGCCCAACCCCTTTCCC
GGACCCCCCAGCTGGCCTCTGAAGCTGGCCCACCAGAGCTGCCATTTGTCTCCAGCCCCT
GGTGTCCAGCTCTTGCCAAAGGGCCTGGAGTAGAAGGACAACAGGGCAGCAACTTGGAGG
GAGTTCTCTGGGGATGGACGGGACCCAGCCTTCTGGGGGTGCTATGAGGTGATCCGTCCC
CACACATGGGATGGGGGAGGCAGAGACTGGTCCAGAGCCCGCAAATGGACTCGGAGCCGA
GGGCCTCCCAGCAGAGCTTGGGAAGGGCCATGGACCCAACTGGGCCCCAGAAGAGCCACA
GGAACATCATTCCTCTCCCGCAACCACTCCCACCCCAGGGAGGCCCTGGCCTCCAGTGCC
TTCCCCCGTGGAATAAACGGTGTGTCCTGAGAAACCAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_021602
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021602.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021602.1, NP_067613.1
RefSeq Size 958 bp
RefSeq ORF 378 bp
Locus ID 974
UniProt ID P40259
Protein Families Druggable Genome, Transmembrane
Protein Pathways B cell receptor signaling pathway
Gene Summary The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site and also lacks an exon in the coding region, compared to variant 3. The encoded isoform (2) is shorter compared to isoform 3, but has identical N- and C- termini.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...