ICEBERG (CARD18) (NM_021571) Human Untagged Clone
CAT#: SC304937
CARD18 (untagged)-Human caspase recruitment domain family, member 18 (CARD18)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ICEBERG; pseudo-ICE; UNQ5804 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304937 representing NM_021571.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGACCAACTCTTGCGTAAAAAGAGAAGAATTTTTATCCATTCAGTGGGTGCAGGCACAATAAAT GCCTTGCTGGATTGCCTATTAGAGGATGAAGTTATTAGCCAGGAAGACATGAACAAAGTGAGAGATGAA AATGACACTGTCATGGATAAGGCTCGAGTCTTGATTGACCTTGTTACTGGAAAAGGACCCAAGTCTTGC TGCAAATTTATCAAGCATCTCTGTGAAGAAGACCCTCAACTTGCCTCAAAGATGGGTTTGCACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021571 |
Insert Size | 273 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021571.3 |
RefSeq Size | 670 bp |
RefSeq ORF | 273 bp |
Locus ID | 59082 |
UniProt ID | P57730 |
Protein Families | Druggable Genome |
Protein Pathways | NOD-like receptor signaling pathway |
MW | 10.1 kDa |
Gene Summary | Inhibits generation of IL-1-beta by interacting with caspase-1 and preventing its association with RIP2. Down-regulates the release of IL1B.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224896 | CARD18 (Myc-DDK-tagged)-Human caspase recruitment domain family, member 18 (CARD18) |
CNY 1,200.00 |
|
RC224896L1 | Lenti ORF clone of Human caspase recruitment domain family, member 18 (CARD18), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC224896L2 | Lenti ORF clone of Human caspase recruitment domain family, member 18 (CARD18), mGFP tagged |
CNY 5,890.00 |
|
RC224896L3 | Lenti ORF clone of Human caspase recruitment domain family, member 18 (CARD18), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224896L4 | Lenti ORF clone of Human caspase recruitment domain family, member 18 (CARD18), mGFP tagged |
CNY 5,890.00 |
|
RG224896 | CARD18 (tGFP-tagged) - Human caspase recruitment domain family, member 18 (CARD18) |
CNY 4,370.00 |
其它ICEBERG产品