HOXD12 (NM_021193) Human Untagged Clone

CAT#: SC304920

HOXD12 (untagged)-Human homeobox D12 (HOXD12)



  "NM_021193" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HOXD12 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HOX4H
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304920 representing NM_021193.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGTGAGCGCAGTCTCTACAGAGCGGGCTATGTGGGCTCGCTTCTGAATCTGCAGTCGCCAGACTCT
TTCTACTTCTCCAACCTGAGGCCGAATGGCGGCCAGTTGGCCGCGCTTCCCCCTATCTCCTACCCGCGC
GGCGCGCTGCCCTGGGCCGCCACGCCCGCCTCCTGCGCCCCCGCGCAGCCTGCGGGCGCCACTGCCTTC
GGCGGCTTCTCGCAGCCCTACCTGGCTGGCTCCGGGCCTCTCGGCCTGCAGCCCCCAACAGCCAAAGAC
GGACCCGAAGAGCAGGCTAAGTTCTATGCGCCCGAAGCGGCCGCTGGGCCAGAGGAGCGCGGTCGTACC
CGGCCGTCCTTCGCCCCCGAGTCTAGCCTGGCTCCTGCAGTGGCTGCTCTCAAAGCGGCCAAGTATGAC
TACGCTGGTGTGGGTCGTGCCACGCCGGGCTCCACGACCCTGCTCCAGGGGGCTCCCTGCGCCCCTGGC
TTCAAGGACGACACCAAGGGCCCGCTCAACTTGAACATGACAGTGCAGGCGGCGGGCGTTGCCTCTTGC
CTGCGACCTTCACTGCCCGACGGCCTGCCGTGGGGGGCGGCCCCGGGGAGGGCCCGCAAGAAGCGGAAA
CCCTACACGAAGCAGCAGATTGCGGAGTTGGAGAACGAATTCCTCGTCAACGAATTCATCAACAGGCAG
AAACGCAAGGAATTGTCCAATAGGCTGAACCTCAGCGACCAGCAAGTCAAAATCTGGTTCCAGAACAGG
CGTATGAAGAAGAAGCGCGTGGTGCTTCGGGAGCAGGCGCTGGCGCTCTACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_021193
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021193.3
RefSeq Size 813 bp
RefSeq ORF 813 bp
Locus ID 3238
UniProt ID P35452
Protein Families Druggable Genome
MW 29 kDa
Gene Summary This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...