SSX3 (NM_021014) Human Untagged Clone

CAT#: SC304892

SSX3 (untagged)-Human synovial sarcoma, X breakpoint 3 (SSX3), transcript variant 1



  "NM_021014" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SSX3 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT5.3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_021014 edited
CTCTCTCTTTCGATTCTTCCATACTCAAGAGTACGCACGGTCTGATTTTCTCTTTGGATT
CTTCCAAAATCAGAGTCAGACTACTCCCTGTGCCATGAACGGAGATGACACCTTTGCAAG
GAGACCCACGGTTGGTGCTCAAATACCAGAGAAGATACAAAAGGCCTTCGATGATATTGC
CAAATACTTCTCTAAGGAAGAGTGGGAAAAGATGAAAGTCTCGGAGAAAATCGTCTATGT
GTATATGAAGAGAAAGTATGAGGCCATGACTAAACTAGGTTTCAAGGCCATCCTCCCATC
TTTCATGCGTAATAAACGGGTCACAGACTTCCAGGGGAATGATTTTGATAATGACCCTAA
CCGTGGGAATCAGGTTCAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTTCCC
GAAGATCATGCCCAAGAAGCCAGCAGAGGAAGGAAATGTTTCGAAGGAAGTGCCAGAAGC
ATCTGGCCCACAAAACGATGGGAAACAGCTGTGCCCCCCGGGAAAACCAACTACCTCTGA
GAAGATTAACATGATATCTGGACCCAAAAGGGGGGAACATGCCTGGACCCACAGACTGCG
TGAGAGAAAGCAGCTGGTGATTTATGAAGAGATCAGCGATCCTGAGGAAGATGATGAGTA
AGCGGCCGCGGTCATAGCTGTTTCC
Restriction Sites Please inquire     
ACCN NM_021014
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021014.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021014.2, NP_066294.1
RefSeq Size 1290 bp
RefSeq ORF 567 bp
Locus ID 10214
UniProt ID Q99909
Protein Families Transcription Factors
Gene Summary The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. While some of the related SSX genes are involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas, this gene does not appear to be involved in such translocations. [provided by RefSeq, Jul 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...