United States
Germany
Japan
United Kingdom
China
gamma C Crystallin (CRYGC) (NM_020989) Human Untagged Clone
CAT＃: SC304887
CRYGC (untagged)-Human crystallin, gamma C (CRYGC)
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CCL; CRYG3; CTRCT2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC304887 representing NM_020989.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGAAGATCACCTTCTATGAGGACAGGGCCTTCCAGGGCCGCAGCTACGAAACCACCACTGACTGC CCCAACCTGCAGCCGTATTTCAGCCGCTGCAACTCCATCCGGGTGGAGAGCGGCTGCTGGATGCTCTAT GAGCGTCCCAACTACCAAGGTCAACAATACTTGCTGCGGCGAGGGGAGTACCCCGACTACCAGCAATGG ATGGGCCTCAGCGACTCCATCCGCTCCTGTTGTCTCATCCCCCAAACAGTCTCCCACAGGCTGCGGCTG TACGAGAGGGAAGACCACAAAGGCCTCATGATGGAGCTGAGTGAAGACTGCCCCAGCATCCAGGACCGC TTCCACCTCAGCGAGATCCGTTCCCTCCACGTGCTGGAGGGCTGCTGGGTCCTCTACGAGCTGCCCAAC TACCGGGGGCGGCAATACCTGCTGAGGCCCCAAGAGTACAGGCGGTGCCAGGACTGGGGGGCCATGGAT GCTAAGGCAGGCTCTTTGCGGAGAGTGGTGGATTTGTATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_020989 |
| Insert Size | 525 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020989.3 |
| RefSeq Size | 645 bp |
| RefSeq ORF | 525 bp |
| Locus ID | 1420 |
| UniProt ID | P07315 |
| Protein Families | Druggable Genome |
| MW | 20.9 kDa |
| Gene Summary | This gene encodes a member of the beta/gamma-crystallin family of proteins. Crystallins constitute the major proteins of vertebrate eye lens and maintain the transparency and refractive index of the lens. This gene and several family members are present in a gene cluster on chromosome 2. Mutations in this gene have been shown to cause multiple types of cataract, including Coppock-like cataract and zonular pulverulent cataract, among others. [provided by RefSeq, Jan 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210386 | CRYGC (Myc-DDK-tagged)-Human crystallin, gamma C (CRYGC) |
CNY 2,400.00 |
|
| RC210386L1 | Lenti ORF clone of Human crystallin, gamma C (CRYGC), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC210386L2 | Lenti ORF clone of Human crystallin, gamma C (CRYGC), mGFP tagged |
CNY 5,890.00 |
|
| RC210386L3 | Lenti ORF clone of Human crystallin, gamma C (CRYGC), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC210386L4 | Lenti ORF clone of Human crystallin, gamma C (CRYGC), mGFP tagged |
CNY 5,890.00 |
|
| RG210386 | CRYGC (tGFP-tagged) - Human crystallin, gamma C (CRYGC) |
CNY 4,000.00 |
其它gamma C Crystallin产品
