United States
Germany
Japan
United Kingdom
China
BCL2L10 (NM_020396) Human Untagged Clone
CAT＃: SC304758
BCL2L10 (untagged)-Human BCL2-like 10 (apoptosis facilitator) (BCL2L10)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BCL-B; bcl2-L-10; Boo; Diva |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_020396 edited
CCAAGAAAACCAGCGAAGGCCCGGCCCCCCAGCAGAGGCCGGACCATGGTTGACCAGTTG CGGGAGCGCACCACCATGGCCGACCCGCTGCGGGAGCGCACCGAGCTGTTGCTGGCCGAC TACCTGGGGTACTGCGCCCGGGAACCCGGCACCCCCGAGCCGGCGCCATCCACGCCCGAG GCCGCCGTGCTGCGCTCCGCGGCCGCCAGGTTACGGCAGATTCACCGGTCCTTTTTCTCC GCCTACCTCGGCTACCCCGGGAACCGCTTCGAGCTGGTGGCGCTGATGGCGGATTCCGTG CTCTCCGACAGCCCCGGCCCCACCTGGGGCAGAGTGGTGACGCTCGTGACCTTCGCAGGG ACGCTGCTGGAGAGAGGGCCGCTGGTGACCGCCCGGTGGAAGAAGTGGGGCTTCCAGCCG CGGCTAAAGGAGCAGGAGGGCGACGTCGCCCGGGACTGCCAGCGCCTGGTGGCCTTGCTG AGCTCGCGGCTCATGGGGCAGCACCGCGCCTGGCTGCAGGCTCAGGGCGGCTGGGATGGC TTTTGTCACTTCTTCAGGACCCCCTTTCCACTGGCTTTTTGGAGAAAACAGCTGGTCCAG GCTTTTCTGTCATGCTTGTTAACAACAGCCTTCATTTATCTCTGGACACGATTATTATGA GTTTTAAAACTTTTAACCCGCTTCTACCTGCCCAACTGTGACCAACTAAATGACAGATGT GTGAGAACAAGAACTGAGGGAAAGCACCTTCCCCCACCCCAGACGTTTTTATCTGAATGC ATACAAGGAGTCCTGAGGTGGTGATTTGGCCAGTGTTTTAACTTGTGACAAGTACTCAGG TGTGAGGACAAGAATGCAAATGGCTCTTCCTTGAGTGAAAGAA |
| Restriction Sites | Please inquire |
| ACCN | NM_020396 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020396.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020396.2, NP_065129.1 |
| RefSeq Size | 887 bp |
| RefSeq ORF | 615 bp |
| Locus ID | 10017 |
| UniProt ID | Q9HD36 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains conserved BH4, BH1 and BH2 domains. This protein can interact with other members of BCL-2 protein family including BCL2, BCL2L1/BCL-X(L), and BAX. Overexpression of this gene has been shown to suppress cell apoptosis possibly through the prevention of cytochrome C release from the mitochondria, and thus activating caspase-3 activation. The mouse counterpart of this protein is found to interact with Apaf1 and forms a protein complex with Caspase 9, which suggests the involvement of this protein in APAF1 and CASPASE 9 related apoptotic pathway. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211604 | BCL2L10 (Myc-DDK-tagged)-Human BCL2-like 10 (apoptosis facilitator) (BCL2L10) |
CNY 2,400.00 |
|
| RC211604L3 | Lenti ORF clone of Human BCL2-like 10 (apoptosis facilitator) (BCL2L10), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC211604L4 | Lenti ORF clone of Human BCL2-like 10 (apoptosis facilitator) (BCL2L10), mGFP tagged |
CNY 5,890.00 |
|
| RG211604 | BCL2L10 (tGFP-tagged) - Human BCL2-like 10 (apoptosis facilitator) (BCL2L10) |
CNY 4,370.00 |
其它BCL2L10产品
