CELA2B (NM_015849) Human Untagged Clone

CAT#: SC304358

CELA2B (untagged)-Human chymotrypsin-like elastase family, member 2B (CELA2B)



  "NM_015849" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ELA2B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304358 representing NM_015849.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATTAGGACCCTGCTGCTGTCCACTTTGGTGGCTGGAGCCCTCAGTTGTGGGGTCTCCACTTACGCG
CCTGATATGTCTAGGATGCTTGGAGGTGAAGAAGCGAGGCCCAACAGCTGGCCCTGGCAGGTCTCCCTG
CAGTACAGCTCCAATGGCCAGTGGTACCACACCTGCGGAGGGTCCCTGATAGCCAACAGCTGGGTCCTG
ACGGCTGCCCACTGCATCAGCTCCTCCGGGATCTACCGCGTGATGCTGGGCCAGCATAACCTCTACGTT
GCAGAGTCCGGCTCGCTGGCCGTCAGTGTCTCTAAGATTGTGGTGCACAAGGACTGGAACTCCGACCAG
GTCTCCAAAGGGAACGACATTGCCCTGCTCAAACTGGCTAACCCCGTCTCCCTCACCGACAAGATCCAG
CTGGCCTGCCTCCCTCCTGCCGGCACCATTCTACCCAACAACTACCCCTGCTACGTCACGGGCTGGGGA
AGGCTGCAGACCAACGGGGCTCTCCCTGATGACCTGAAGCAGGGCCGGTTGCTGGTTGTGGACTATGCC
ACCTGCTCCAGCTCTGGCTGGTGGGGCAGCACCGTGAAGACGAATATGATCTGTGCTGGGGGTGATGGC
GTGATATGCACCTGCAACGGAGACTCCGGTGGGCCGCTGAACTGTCAGGCATCTGACGGCCGGTGGGAG
GTGCATGGCATCGGCAGCCTCACGTCGGTCCTTGGTTGCAACTACTACTACAAGCCCTCCATCTTCACG
CGGGTCTCCAACTACAACGACTGGATCAATTCGGTGATTGCAAATAACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_015849
Insert Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015849.2
RefSeq Size 941 bp
RefSeq ORF 810 bp
Locus ID 51032
UniProt ID P08218
Protein Families Druggable Genome, Secreted Protein
MW 28.8 kDa
Gene Summary Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Like most of the human elastases, elastase 2B is secreted from the pancreas as a zymogen. In other species, elastase 2B has been shown to preferentially cleave proteins after leucine, methionine, and phenylalanine residues. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...