GPR162 (NM_014449) Human Untagged Clone
CAT#: SC304111
GPR162 (untagged)-Human G protein-coupled receptor 162 (GPR162), transcript variant A-1
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | A-2; GRCA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_014449 edited
CCATCATGCAATGCTGAGCACTGGGGTGGTGAGCTTCTTCTCCCTCAAGTCGGACTCGGC GCCCCCCTGGATGGTGCTGGCTGTGCTGTGGTGCTCCATGGCACAGACGCTGCTGCTGCC CTCCTTCATCTGGTCCTGCGAGCGCTACCGCGCCGACGTGCGCACAGTGTGGGAGCAATG CGTGGCCATCATGTCTGAGGAGGATGGAGATGACGATGGGGGCTGTGACGACTATGCAGA GGGCCGAGTTTGCAAAGTTCGCTTTGATGCTAACGGAGCCACAGGACCAGGGAGCCGGGA CCCCGCCCAGGTGAAGCTGCTGCCTGGAAGGCACATGCTCTTCCCTCCTCTTGAGAGAGT CCACTACTTACAGGTCCCCCTATCCCGGCGTCTGTCCCATGATGAGACAAACATCTTCTC TACCCCTCGGGAACCAGGCTCCTTCCTGCACAAGTGGTCATCCTCTGATGACATCCGGGT CCTCCCAGCCCAGAGCCGGGCCCTCGGGGGTCCTCCTGAGTACCTGGGACAAAGACACAG GTTGGAGGACGAGGAGGACGAGGAAGAGGCTGAAGGTGGGGGGCTGGCCAGCCTTCGCCA ATTCTTGGAGAGTGGGGTTCTGGGGTCAGGTGGGGGACCCCCACGGGGTCCTGGCTTCTT CCGGGAGGAGATCACCACCTTCATCGATGAGACACCTCTGCCTTCTCCGACTGCCTCACC AGGGCACTCTCCTCGTCGGCCCCGGCCACTGGGCCTCTCACCCCGCCGACTCTCCCTTGG GTCCCCTGAGAGCAGAGCCGTTGGACTTCCTTTGGGACTAAGCGCAGGGAGACGCTGCTC CCTGACGGGGGGTGAAGAAAGTGCAAGGGCTTGGGGAGGATCCTGGGGCCCAGGCAACCC CATCTTTCCCCAGCTGACCCTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_014449 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014449.1, NP_055264.1 |
RefSeq Size | 1514 bp |
RefSeq ORF | 915 bp |
Locus ID | 27239 |
UniProt ID | Q16538 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | This gene was identified upon genomic analysis of a gene-dense region at human chromosome 12p13. It appears to be mainly expressed in the brain; however, its function is not known. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (A-1) differs in the 5' UTR and the 5' coding region, compared to variant A-2. The resulting isoform (1) contains a distinct N-terminus, compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201764 | GPR162 (Myc-DDK-tagged)-Human G protein-coupled receptor 162 (GPR162), transcript variant A-1 |
CNY 2,400.00 |
|
RC201764L3 | Lenti ORF clone of Human G protein-coupled receptor 162 (GPR162), transcript variant A-1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201764L4 | Lenti ORF clone of Human G protein-coupled receptor 162 (GPR162), transcript variant A-1, mGFP tagged |
CNY 5,890.00 |
|
RG201764 | GPR162 (tGFP-tagged) - Human G protein-coupled receptor 162 (GPR162), transcript variant A-1 |
CNY 4,000.00 |