ETV2 (NM_014209) Human Untagged Clone
CAT#: SC304062
ETV2 (untagged)-Human ets variant 2 (ETV2)
CNY 5,488.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ER71; ETSRP71 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_014209 edited
ATGGACCTGTGGAACTGGGATGAGGCATCCCCACAGGAAGTGCCTCCAGGGAACAAGCTG GCAGGGCTTGAAGGAGCCAAATTAGGCTTCTGTTTCCCTGATCTGGCACTCCAAGGGGAC ACGCCGACAGCGACAGCAGAGACATGCTGGAAAGGTACAAGCTCATCCCTGGCAAGCTTC CCACAGCTGGACTGGGGCTCCGCGTTACTGCACCCAGAAGTTCCATGGGGGGCGGAGCCC GACTCTCAGGCTCTTCCGTGGTCCGGGGACTGGACAGACATGGCGTGCACAGCCTGGGAC TCTTGGAGCGGCGCCTCGCAGACCCTGGGCCCCGCCCCTCTCGGCCCGGGCCCCATCCCC GCCGCCGGCTCCGAAGGCGCCGCGGGCCAGAACTGCGTCCCCGTGGCGGGAGAGGCCACC TCGTGGTCGCGCGCCCAGGCCGCCGGGAGCAACACCAGCTGGGACTGTTCTGTGGGGCCC GACGGCGATACCTACTGGGGCAGTGGCCTGGGCGGGGAGCCGCGCACGGACTGTACCATT TCGTGGGGCGGGCCCGCGGGCCCGGACTGTACCACCTCCTGGAACCCGGGGCTGCATGCG GGTGGCACCACCTCTTTGAAGCGGTACCAGAGCTCAGCTCTCACCGTTTGCTCCGAACCG AGCCCGCAGTCGGACCGTGCCAGTTTGGCTCGATGCCCCAAAACTAACCACCGAGGTCCC ATTCAGCTGTGGCAGTTCCTCCTGGAGCTGCTCCACGACGGGGCGCGTAGCAGCTGCATC CGTTGGACTGGCAACAGCCGCGAGTTCCAGCTGTGCGACCCCAAAGAGGTGGCTCGGCTG TGGGGCGAGCGCAAGAGAAAGCCGGGCATGAATTACGAGAAGCTGAGCCGGGGCCTTCGC TACTACTATCGCCGCGACATCGTGCGCAAGAGCGGGGGGCGAAAGTACACGTACCGCTTC GGGGGCCGCGTGCCCAGCCTAGCCTATCCGGACTGTGCGGGAGGCGGACGGGGAGCAGAG ACACAATAA |
Restriction Sites | NotI-NotI |
ACCN | NM_014209 |
Insert Size | 1600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | It is not a varient. But 5' and 3' UTRs are different from reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014209.1, NP_055024.1 |
RefSeq Size | 1559 bp |
RefSeq ORF | 1113 bp |
Locus ID | 2116 |
UniProt ID | O00321 |
Protein Families | ES Cell Differentiation/IPS |
Gene Summary | Binds to DNA sequences containing the consensus pentanucleotide 5'-CGGA[AT]-3'.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213907 | ETV2 (Myc-DDK-tagged)-Human ets variant 2 (ETV2) |
CNY 5,488.00 |
|
RC213907L1 | Lenti-ORF clone of ETV2 (Myc-DDK-tagged)-Human ets variant 2 (ETV2) |
CNY 7,888.00 |
|
RC213907L2 | Lenti-ORF clone of ETV2 (mGFP-tagged)-Human ets variant 2 (ETV2) |
CNY 7,888.00 |
|
RC213907L3 | Lenti-ORF clone of ETV2 (Myc-DDK-tagged)-Human ets variant 2 (ETV2) |
CNY 7,888.00 |
|
RC213907L4 | Lenti-ORF clone of ETV2 (mGFP-tagged)-Human ets variant 2 (ETV2) |
CNY 7,888.00 |
|
RG213907 | ETV2 (tGFP-tagged) - Human ets variant 2 (ETV2) |
CNY 7,088.00 |