CNIH4 (NM_014184) Human Untagged Clone

CAT#: SC304059

CNIH4 (untagged)-Human cornichon homolog 4 (Drosophila) (CNIH4)



  "NM_014184" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CNIH-4; CNIH2; HSPC163
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_014184 edited
AGCGAGGCCTGGGTGGCGGGAAGGAGCGGCGGCGACGGAGGAGGAGGATGGAGGCGGTGG
TGTTCGTCTTCTCTCTCCTCGATTGTTGCGCGCTCATCTTCCTCTCGGTCTACTTCATAA
TTACATTGTCTGATTTAGAATGTGATTACATTAATGCTAGATCATGTTGCTCAAAATTAA
ACAAGTGGGTAATTCCAGAATTGATTGGCCATACCATTGTCACTGTATTACTGCTCATGT
CATTGCACTGGTTCATCTTCCTTCTCAACTTACCTGTTGCCACTTGGAATATATATCGAT
ACATTATGGTGCCGAGTGGTAACATGGGAGTGTTTGATCCAACAGAAATACACAATCGAG
GGCAGCTGAAGTCACACATGAAAGAAGCCATGATCAAGCTTGGTTTCCACTTGCTCTGCT
TCTTCATGTATCTTTATAGTATGATCTTAGCTTTGATAAATGACTGAAGCTGGAGAAGCC
GTGGTTGAAGTCAGCCTACACTACAGTGCACAGTTGAGGAGCCAGAGACTTCTTAAATCA
TCCTTAGAACCGTGACCATAGCAGTATATATTTTCCTCTTGGAACAAAAAACTATTTTTG
CTGTATTTTTACCATATAAAGTATTTAAAAAACATGAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI     
ACCN NM_014184
Insert Size 650 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to match NM_014184.1 perfectly.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014184.1, NP_054903.1
RefSeq Size 652 bp
RefSeq ORF 420 bp
Locus ID 29097
UniProt ID Q9P003
Protein Families Transmembrane
Gene Summary Involved in G protein-coupled receptors (GPCRs) trafficking from the endoplasmic reticulum to the cell surface; it promotes the exit of GPCRs from the early secretory pathway, likely through interaction with the COPII machinery (PubMed:24405750).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note:.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...