United States
Germany
Japan
United Kingdom
China
MOX1 (MEOX1) (NM_013999) Human Untagged Clone
CAT＃: SC304030
MEOX1 (untagged)-Human mesenchyme homeobox 1 (MEOX1), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | KFS2; MOX1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_013999, the custom clone sequence may differ by one or more nucleotides
ATGGATCCCGCGGCCAGCAGCTGCATGAGGAGCCTCCAGCCCCCAGCCCCTGTCTGGGGC TGCCTTCGAAACCCCCACTCGGAAGGCAATGGGGCCTCAGGGCTACCCCACTACCCGCCC ACCCCGTTCTCCTTCCACCAGAAACCAGACTTCCTGGCGACAGCGACGGCAGCGTACCCT GACTTCTCAGCCTCCTGCCTGGCAGCCACCCCACACAGCCTGCCCCAGGAGGAGCACATC TTCACTGAGCAGCACCCCGCTTTCCCACAGTCCCCCAACTGGCACTTCCCTGTCTCAGAC GCCCGGCGCAGGCCCAACTCAGGCCCGGCAGGGGGTTCCAAGGAAATGGGGACCAGCAGC CTGGGCCTGGTGGACACCACAGGAGGCCCAGGCGATGACTACGGGGTGCTTGGGAGCACT GCCAATGAGACAGAGAAGAAATCATCCAGGCGGAGAAAGGAGAGTTCAGGTCAAAGTGTG GTTCCAGAACCGAAGGATGAAGTGGAAGCGTGTGAAGGGAGGTCAGCCCATCTCCCCCAA TGGGCAGGACCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_013999 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_013999.3, NP_054705.1 |
| RefSeq Size | 2157 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 4222 |
| UniProt ID | P50221 |
| Protein Families | Transcription Factors |
| Gene Summary | This gene encodes a member of a subfamily of non-clustered, diverged, antennapedia-like homeobox-containing genes. The encoded protein may play a role in the molecular signaling network regulating somite development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the coding region that results in a frameshift and a premature stop codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221643 | MEOX1 (Myc-DDK-tagged)-Human mesenchyme homeobox 1 (MEOX1), transcript variant 2 |
CNY 3,990.00 |
|
| RC221643L3 | Lenti-ORF clone of MEOX1 (Myc-DDK-tagged)-Human mesenchyme homeobox 1 (MEOX1), transcript variant 2 |
CNY 5,890.00 |
|
| RC221643L4 | Lenti-ORF clone of MEOX1 (mGFP-tagged)-Human mesenchyme homeobox 1 (MEOX1), transcript variant 2 |
CNY 5,890.00 |
|
| RG221643 | MEOX1 (tGFP-tagged) - Human mesenchyme homeobox 1 (MEOX1), transcript variant 2 |
CNY 4,370.00 |
