PAX8 (NM_013953) Human Untagged Clone

CAT#: SC304021

PAX8 (untagged)-Human paired box 8 (PAX8), transcript variant PAX8D



  "NM_013953" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to PAX8CC (paired box 8)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304021 representing NM_013953.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTCACAACTCCATCAGATCTGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTTGTGAATGGC
AGACCTCTGCCGGAAGTGGTCCGCCAGCGCATCGTAGACCTGGCCCACCAGGGTGTAAGGCCCTGCGAC
ATCTCTCGCCAGCTCCGCGTCAGCCATGGCTGCGTCAGCAAGATCCTTGGCAGGTACTACGAGACTGGC
AGCATCCGGCCTGGAGTGATAGGGGGCTCCAAGCCCAAGGTGGCCACCCCCAAGGTGGTGGAGAAGATT
GGGGACTACAAACGCCAGAACCCTACCATGTTTGCCTGGGAGATCCGAGACCGGCTCCTGGCTGAGGGC
GTCTGTGACAATGACACTGTGCCCAGTGTCAGCTCCATTAATAGAATCATCCGGACCAAAGTGCAGCAA
CCATTCAACCTCCCTATGGACAGCTGCGTGGCCACCAAGTCCCTGAGTCCCGGACACACGCTGATCCCC
AGCTCAGCTGTAACTCCCCCGGAGTCACCCCAGTCGGATTCCCTGGGCTCCACCTACTCCATCAATGGG
CTCCTGGGCATCGCTCAGCCTGGCAGCGACAAGAGGAAAATGGATGACAGTGATCAGGATAGCTGCCGA
CTAAGCATTGACTCACAGAGCAGCAGCAGCGGACCCCGAAAGCACCTTCGCACGGATGCCTTCAGCCAG
CACCACCTCGAGCCGCTCGAGTGCCCATTTGAGCGGCAGCACTACCCAGAGGCCTATGCCTCCCCCAGC
CACACCAAAGGCGAGCAGGGCGAGAGATGGTGGGGCCCACGCTGCCCGGATACCCACCCCACATCCCCA
CCAGCGGACAGGGCAGCTATGCCTCCTCTGCCATCGCAGGCATGGTGGCAGGAAGTGAATACTCTGGCA
ATGCCTATGGCCACACCCCCTACTCCTCCTACAGCGAGGCCTGGCGCTTCCCCAACTCCAGCTTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_013953
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013953.3
RefSeq Size 3755 bp
RefSeq ORF 966 bp
Locus ID 7849
UniProt ID Q06710
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Pathways in cancer, Thyroid cancer
MW 34.9 kDa
Gene Summary This gene encodes a member of the paired box (PAX) family of transcription factors. Members of this gene family typically encode proteins that contain a paired box domain, an octapeptide, and a paired-type homeodomain. This nuclear protein is involved in thyroid follicular cell development and expression of thyroid-specific genes. Mutations in this gene have been associated with thyroid dysgenesis, thyroid follicular carcinomas and atypical follicular thyroid adenomas. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (PAX8D) lacks two alternate exons, compared to variant PAX8A, that results in a frameshift and an early stop codon. The encoded isoform (PAX8D) is shorter and has a distinct C-terminus compared to isoform PAX8A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...