PAX8 (NM_013952) Human Untagged Clone
CAT#: SC304020
PAX8 (untagged)-Human paired box 8 (PAX8), transcript variant PAX8C
CNY 6,460.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_013952, the custom clone sequence may differ by one or more nucleotides
ATGCCTCACAACTCCATCAGATCTGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTT GTGAATGGCAGACCTCTGCCGGAAGTGGTCCGCCAGCGCATCGTAGACCTGGCCCACCAG GGTGTAAGGCCCTGCGACATCTCTCGCCAGCTCCGCGTCAGCCATGGCTGCGTCAGCAAG ATCCTTGGCAGGTACTACGAGACTGGCAGCATCCGGCCTGGAGTGATAGGGGGCTCCAAG CCCAAGGTGGCCACCCCCAAGGTGGTGGAGAAGATTGGGGACTACAAACGCCAGAACCCT ACCATGTTTGCCTGGGAGATCCGAGACCGGCTCCTGGCTGAGGGCGTCTGTGACAATGAC ACTGTGCCCAGTGTCAGCTCCATTAATAGAATCATCCGGACCAAAGTGCAGCAACCATTC AACCTCCCTATGGACAGCTGCGTGGCCACCAAGTCCCTGAGTCCCGGACACACGCTGATC CCCAGCTCAGCTGTAACTCCCCCGGAGTCACCCCAGTCGGATTCCCTGGGCTCCACCTAC TCCATCAATGGGCTCCTGGGCATCGCTCAGCCTGGCAGCGACAAGAGGAAAATGGATGAC AGTGATCAGGATAGCTGCCGACTAAGCATTGACTCACAGAGCAGCAGCAGCGGACCCCGA AAGCACCTTCGCACGGATGCCTTCAGCCAGCACCACCTCGAGCCGCTCGAGTGCCCATTT GAGCGGCAGCACTACCCAGAGGCCTATGCCTCCCCCAGCCACACCAAAGGCGAGCAGGGC CTCTACCCGCTGCCCTTGCTCAACAGCACCCTGGACGACGGGAAGGCCACCCTGACCCCT TCCAACACGCCACTGGGGCGCAACCTCTCGACTCACCAGACCTACCCCGTGGTGGCAGCT CCGCCTTTTTGGATCTGCAGCAAGTCGGCTCCGGGGTCCCGCCCTTCAATGCCTTTCCCC ATGCTGCCTCCGTGTACGGGCAGTTCACGGGCCAGGCCCTCCTCTCAGGGCGAGAGATGG TGGGGCCCACGCTGCCCGGATACCCACCCCACATCCCCACCAGCGGACAGGGCAGCTATG CCTCCTCTGCCATCGCAGGCATGGTGGCAGGAAGTGAATACTCTGGCAATGCCTATGGCC ACACCCCCTACTCCTCCTACAGCGAGGCCTGGCGCTTCCCCAACTCCAGCTTGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_013952 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013952.3, NP_039246.1 |
RefSeq Size | 3986 bp |
RefSeq ORF | 1197 bp |
Locus ID | 7849 |
UniProt ID | Q06710 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Pathways in cancer, Thyroid cancer |
Gene Summary | This gene encodes a member of the paired box (PAX) family of transcription factors. Members of this gene family typically encode proteins that contain a paired box domain, an octapeptide, and a paired-type homeodomain. This nuclear protein is involved in thyroid follicular cell development and expression of thyroid-specific genes. Mutations in this gene have been associated with thyroid dysgenesis, thyroid follicular carcinomas and atypical follicular thyroid adenomas. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (PAX8C) uses an alternate splice site in the 3' coding region, compared to variant PAX8A, that results in a frameshift and an early stop codon. It encodes isoform PAX8C which has a shorter and distinct C-terminus compared to isoform PAX8A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214129 | PAX8 (Myc-DDK-tagged)-Human paired box 8 (PAX8), transcript variant PAX8C |
CNY 3,656.00 |
|
RC214129L3 | Lenti-ORF clone of PAX8 (Myc-DDK-tagged)-Human paired box 8 (PAX8), transcript variant PAX8C |
CNY 5,890.00 |
|
RC214129L4 | Lenti-ORF clone of PAX8 (mGFP-tagged)-Human paired box 8 (PAX8), transcript variant PAX8C |
CNY 5,890.00 |
|
RG214129 | PAX8 (tGFP-tagged) - Human paired box 8 (PAX8), transcript variant PAX8C |
CNY 4,370.00 |