United States
Germany
Japan
United Kingdom
China
VCX (NM_013452) Human Untagged Clone
CAT＃: SC304010
VCX (untagged)-Human variable charge, X-linked (VCX)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | VCX-10r; VCX-B1; VCX1; VCX10R; VCXB1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC304010 representing NM_013452.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTCCAAAGCCGAGAGCCTCGGGACCTCCGGCCAAGGCCACGGAGGCAGGAAAGAGGAAGTCCTCC TCTCAGCCGAGCCCCAGTGACCCGAAGAAGAAGACTACCAAGGTGGCCAAGAAGGGAAAAGCAGTTCGT AGAGGGAGACGCGGGAAGAAAGGGGCTGCGACAAAGATGGCGGCCGTGACGGCACCTGAGGCGGAGAGC GCGCCAGCGGCACCCGGCCCCAGCGACCAGCCCAGCCAGGAGCTCCCTCAGCACGAGCTGCCGCCGGAG GAGCCAGTGAGCGAGGGGACCCAGCACGACCCCCTGAGTCAGGAGGCCGAGCTGGAGGAACCACTGAGT CAGGAGAGCGAGGTGGAAGAACCACTGAGTCAGGAGAGCCAGGTGGAGGAACCACTGAGTCAGGAGAGC GAGGTGGAAGAACCACTGAGTCAGGAGAGCCAGGTGGAGGAACCACTGAGTCAGGAGAGCGAGGTGGAG GAACCACTGAGTCAGGAGAGCCAGGTGGAGGAACCACTGAGTCAGGAGAGCGAGATGGAAGAACCACTG AGTCAGGAGAGCCAGGTGGAGGAACCACCGAGTCAGGAGAGCGAGATGGAAGAACTACCGAGTGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_013452 |
| Insert Size | 621 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013452.2 |
| RefSeq Size | 976 bp |
| RefSeq ORF | 621 bp |
| Locus ID | 26609 |
| UniProt ID | Q9H320 |
| MW | 22.3 kDa |
| Gene Summary | This gene belongs to the VCX/Y gene family, which has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. The X-linked members are clustered on chromosome Xp22 and Y-linked members are two identical copies of the gene within a palindromic region on Yq11. The family members share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. The VCX gene cluster is polymorphic in terms of copy number; different individuals may have a different number of VCX genes. VCX/Y genes encode small and highly charged proteins of unknown function. The presence of a putative bipartite nuclear localization signal suggests that VCX/Y members are nuclear proteins. This gene contains 10 repeats of the 30-bp unit. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224497 | VCX (Myc-DDK-tagged)-Human variable charge, X-linked (VCX) |
CNY 2,400.00 |
|
| RC224497L1 | Lenti ORF clone of Human variable charge, X-linked (VCX), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC224497L2 | Lenti ORF clone of Human variable charge, X-linked (VCX), mGFP tagged |
CNY 5,890.00 |
|
| RC224497L3 | Lenti ORF clone of Human variable charge, X-linked (VCX), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224497L4 | Lenti ORF clone of Human variable charge, X-linked (VCX), mGFP tagged |
CNY 5,890.00 |
|
| RG224497 | VCX (tGFP-tagged) - Human variable charge, X-linked (VCX) |
CNY 4,370.00 |
