RAX (NM_013435) Human Untagged Clone
CAT#: SC304009
RAX (untagged)-Human retina and anterior neural fold homeobox (RAX)
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MCOP3; RX |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene ORF sequence for NM_013435 edited
ATGCACCTGCCGGGCTGCGCGCCAGCCATGGCCGACGGGAGCTTCTCGCTTGCCGGCCAC CTGCTCCGCAGCCCGGGCGGGAGCACCTCGCGACTTCACAGCATCGAGGCCATCCTGGGG TTTACCAAGGACGACGGGATCCTCGGCACCTTCCCGGCGGAGCGGGGCGCCCGGGGCGCG AAGGAGCGGGATAGGAGGCTGGGCGCGCGGCCCGCCTGCCCCAAGGCGCCCGAGGAAGGC TCCGAGCCCTCCCCGCCGCCAGCCCCGGCGCCCGCCCCCGAGTACGAAGCCCCTCGACCC TACTGCCCCAAGGAGCCCGGGGAGGCACGGCCGAGCCCAGGGCTGCCCGTCGGGCCAGCC ACCGGCGAAGCGAAACTGTCAGAGGAGGAACAGCCCAAGAAAAAGCATCGGCGGAACCGC ACGACTTTCACCACGTACCAGCTGCATGAGCTGGAGCGCGCGTTCGAGAAGTCCCACTAC CCGGACGTGTACAGCCGCGAGGAGCTGGCCGGCAAGGTCAACCTACCAGAGGTCCGGGTC CAGGTGTGGTTCCAGAACCGACGGGCTAAGTGGCGGCGGCAGGAGAAGCTGGAAGTGTCC TCCATGAAGCTGCAGGACTCGCCCCTCCTCTCCTTCAGCCGCTCCCCGCCCTCCGCGACG CTGTCGCCCCTCGGGGCGGGCCCGGGCAGCGGTGGCGGGCCGGCTGGGGGCGCGCTGCCG CTGGAGTCCTGGCTCGGGCCGCCGCTGCCGGGCGGGGGCGCCACGGCGCTGCAGAGCCTG CCGGGCTTCGGGCCGCCGGCGCAGAGCCTGCCTGCCAGCTACACGCCACCGCCGCCGCCT CCGCCCTTCCTGAACTCCCCGCCGTTGGGCCCCGGCCTGCAACCTCTCGCGCCGCCGCCG CCCTCCTACCCGTGCGGGCCCGGCTTCGGGGACAAGTTCCCGCTGGACGAGGCGGACCCG CGCAACAGCAGCATCGCGGCGCTGCGTCTGAAAGCCAAGGAGCACATCCAGGCCATCGGG AAGCCGTGGCAGGCCCTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_013435 |
Insert Size | 1000 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_013435.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013435.1, NP_038463.1 |
RefSeq Size | 1775 bp |
RefSeq ORF | 1041 bp |
Locus ID | 30062 |
UniProt ID | Q9Y2V3 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219896 | RAX (Myc-DDK-tagged)-Human retina and anterior neural fold homeobox (RAX) |
CNY 5,488.00 |
|
RC219896L1 | Lenti ORF clone of Human retina and anterior neural fold homeobox (RAX), Myc-DDK-tagged |
CNY 7,888.00 |
|
RC219896L2 | Lenti ORF clone of Human retina and anterior neural fold homeobox (RAX), mGFP tagged |
CNY 5,890.00 |
|
RC219896L3 | Lenti ORF clone of Human retina and anterior neural fold homeobox (RAX), Myc-DDK-tagged |
CNY 7,888.00 |
|
RC219896L4 | Lenti ORF clone of Human retina and anterior neural fold homeobox (RAX), mGFP tagged |
CNY 7,888.00 |
|
RG219896 | RAX (tGFP-tagged) - Human retina and anterior neural fold homeobox (RAX) |
CNY 7,088.00 |