BRDG 1 (STAP1) (NM_012108) Human Untagged Clone

CAT#: SC303927

STAP1 (untagged)-Human signal transducing adaptor family member 1 (STAP1)



  "NM_012108" in other vectors (4)

CNY 2,640.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


STAP1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRDG1; STAP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303927 representing NM_012108.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGGCTAAGAAGCCCCCAAAACCAGCCCCTCGCAGGATCTTCCAGGAAAGGTTAAAGATTACTGCT
CTACCTTTGTACTTTGAAGGTTTTTTATTAATCAAGCGGTCAGGATACCGGGAGTATGAGCATTACTGG
ACAGAGTTGAGAGGAACTACTCTTTTCTTTTATACCGACAAAAAGAGTATAATATATGTTGACAAATTA
GACATAGTAGACCTCACATGCCTTACTGAGCAGAATTCAACTGAAAAGAACTGTGCGAAATTCACCCTT
GTTTTGCCGAAAGAGGAAGTACAACTGAAGACAGAGAACACAGAAAGTGGGGAAGAATGGAGAGGCTTC
ATTCTTACAGTAACAGAGCTGTCAGTTCCCCAAAACGTGTCACTCCTACCTGGGCAAGTAATTAAACTG
CATGAAGTCCTAGAGAGAGAAAAGAAAAGGAGGATTGAGACAGAGCAGAGTACGTCCGTGGAAAAAGAG
AAGGAACCAACTGAAGATTATGTGGATGTACTGAACCCTATGCCAGCATGTTTTTATACAGTGTCCCGG
AAAGAGGCAACTGAGATGCTCCAGAAGAACCCTTCTTTGGGAAATATGATCCTGAGGCCTGGTAGTGAC
AGTAGAAACTACTCCATCACTATTCGGCAGGAGATAGACATTCCAAGAATCAAGCACTACAAAGTGATG
AGCGTAGGACAAAACTACACTATTGAACTGGAAAAACCTGTAACACTCCCAAACCTTTTCAGTGTCATT
GATTATTTTGTGAAGGAGACTCGAGGAAATTTAAGACCATTTATATGTTCAACTGATGAAAACACTGGT
CAAGAACCCAGTATGGAAGGGAGAAGTGAAAAGTTGAAGAAAAATCCACACATTGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_012108
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_012108.3
RefSeq Size 2011 bp
RefSeq ORF 888 bp
Locus ID 26228
UniProt ID Q9ULZ2
Protein Families Druggable Genome
MW 34.3 kDa
Gene Summary The protein encoded by this gene contains a proline-rich region, a pleckstrin homology (PH) domain, and a region in the carboxy terminal half with similarity to the Src Homology 2 (SH2) domain. This protein is a substrate of tyrosine-protein kinase Tec, and its interaction with tyrosine-protein kinase Tec is phosphorylation-dependent. This protein is thought to participate in a positive feedback loop by upregulating the activity of tyrosine-protein kinase Tec. Variants of this gene have been associated with autosomal-dominant hypercholesterolemia (ADH), which is characterized by elevated low-density lipoprotein cholesterol levels and in increased risk of coronary vascular disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...