Aquaporin 0 (MIP) (NM_012064) Human Untagged Clone
CAT#: SC303924
MIP (untagged)-Human major intrinsic protein of lens fiber (MIP)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AQP0; CTRCT15; LIM1; MIP26; MP26 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_012064 edited
GTAGCAGGGACCCAGGCACTGTGACCATCCCCCCTGCCATGTGGGAACTGCGATCAGCCT CCTTTTGGAGGGCCATATTCGCTGAGTTCTTTGCCACCCTCTTCTATGTCTTCTTTGGGC TGGGGTCCTCACTGCGCTGGGCTCCTGGACCCCTGCATGTTCTGCAGGTGGCTATGGCAT TTGGCTTGGCCCTGGCTACACTGGTGCAGTCTGTGGGCCACATCAGTGGAGCCCACGTCA ATCCTGCAGTCACTTTTGCTTTCCTTGTGGGCTCCCAGATGTCCCTGCTCCGTGCCTTCT GCTATATGGCAGCCCAGCTCCTGGGAGCTGTGGCTGGGGCCGCTGTGCTGTATAGCGTTA CCCCACCTGCTGTCCGAGGAAACCTAGCACTCAACACGTTGCACCCTGCGGTGAGCGTGG GCCAGGCAACCACAGTGGAGATCTTCCTGACGCTCCAGTTCGTGCTCTGCATCTTTGCCA CATACGACGAGAGGCGGAATGGCCAACTGGGCTCCGTGGCCCTGGCCGTTGGCTTCTCCC TTGCCCTGGGGCACCTCTTTGGGATGTATTATACTGGTGCAGGCATGAATCCTGCCCGCT CCTTTGCTCCTGCCATTCTCACTGGGAACTTCACTAACCACTGGGTGTACTGGGTAGGCC CAATCATTGGAGGGGGTCTGGGCAGCCTCCTGTACGACTTTCTTCTCTTCCCCCGGCTCA AGAGTATTTCTGAGAGACTGTCTGTCCTCAAGGGTGCCAAACCCGATGTCTCCAATGGAC AACCAGAGGTCACAGGGGAACCTGTTGAACTGAACACCCAGGCCCTGTAGAAGCTCCAGC TGAATAGAGGGAGTAGAAAGCTTCTGAGTTTACGTGGAGGGGTTTAGCCAGCCCCTAGAT GAAGAAAGAGACTGTGGGGAGGGGCATGTACTTC |
Restriction Sites | Please inquire |
ACCN | NM_012064 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_012064.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012064.2, NP_036196.1 |
RefSeq Size | 2004 bp |
RefSeq ORF | 792 bp |
Locus ID | 4284 |
UniProt ID | P30301 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Major intrinsic protein is a member of the water-transporting aquaporins as well as the original member of the MIP family of channel proteins. The function of the fiber cell membrane protein encoded by this gene is undetermined, yet this protein is speculated to play a role in intracellular communication. The MIP protein is expressed in the ocular lens and is required for correct lens function. This gene has been mapped among aquaporins AQP2, AQP5, and AQP6, in a potential gene cluster at 12q13. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216810 | MIP (Myc-DDK-tagged)-Human major intrinsic protein of lens fiber (MIP) |
CNY 2,400.00 |
|
RC216810L3 | Lenti ORF clone of Human major intrinsic protein of lens fiber (MIP), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216810L4 | Lenti ORF clone of Human major intrinsic protein of lens fiber (MIP), mGFP tagged |
CNY 5,890.00 |
|
RG216810 | MIP (tGFP-tagged) - Human major intrinsic protein of lens fiber (MIP) |
CNY 4,370.00 |
其它Aquaporin 0产品