RIP3 (RIPK3) (NM_006871) Human Untagged Clone
CAT#: SC303834
RIPK3 (untagged)-Human receptor-interacting serine-threonine kinase 3 (RIPK3)
CNY 5,800.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RIP3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_006871, the custom clone sequence may differ by one or more nucleotides
ATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACC AGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGT GGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAA TTCGTGCTGCGCCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGA CTAAATTCATGGAGAACGGCTCCTTGTCGGGGCTGCTGCAGTCCCAGTGCCCTCGGCCCTGGCCGCTCCT TTGCCGCCTGCTGAAAGAAGTGGTGCTTGGGATGTTTTACCTGCACGACCAGAACCCGGTGCTCCTGCAC CGGGACCTCAAGCCATCCAACGTCCTGCTGGACCCAGAGCTGCACGTCAAGCTGGCAGATTTTGGCCTGT CCACATTTCAGGGAGGCTCACAGTCAGGGACAGGGTCCGGGGAGCCAGGGGGCACCCTGGGCTACTTGGC CCCAGAACTGTTTGTTAACGTAAACCGGAAGGCCTCCACAGCCAGTGACGTCTACAGCTTCGGGATCCTA ATGTGGGCAGTGCTTGCTGGAAGAGAAGTTGAGTTGCCAACCGAACCATCACTCGTGTACGAAGCAGTGT GCAACAGGCAGAACCGGCCTTCATTGGCTGAGCTGCCCCAAGCCGGGCCTGAGACTCCCGGCTTAGAAGG ACTGAAGGAGCTAATGCAGCTCTGCTGGAGCAGTGAGCCCAAGGACAGACCCTCCTTCCAGGAATGCCTA CCAAAAACTGATGAAGTCTTCCAGATGGTGGAGAACAATATGAATGCTGCTGTCTCCACGGTAAAGGATT TCCTGTCTCAGCTCAGGAGCAGCAATAGGAGATTTTCTATCCCAGAGTCAGGCCAAGGAGGGACAGAAAT GGATGGCTTTAGGAGAACCATAGAAAACCAGCACTCTCGTAATGATGTCATGGTTTCTGAGTGGCTAAAC AAACTGAATCTAGAGGAGCCTCCCAGCTCTGTTCCTAAAAAATGCCCGAGCCTTACCAAGAGGAGCAGGG CACAAGAGGAGCAGGTTCCACAAGCCTGGACAGCAGGCACATCTTCAGATTCGATGGCCCAACCTCCCCA GACTCCAGAGACCTCAACTTTCAGAAACCAGATGCCCAGCCCTACCTCAACTGGAACACCAAGTCCTGGA CCCCGAGGGAATCAGGGGGCTGAGAGACAAGGCATGAACTGGTCCTGCAGGACCCCGGAGCCAAATCCAG TAACAGGGCGACCGCTCGTTAACATATACAACTGCTCTGGGGTGCAAGTTGGAGACAACAACTACTTGAC TATGCAACAGACAACTGCCTTGCCCACATGGGGCTTGGCACCTTCGGGCAAGGGGAGGGGCTTGCAGCAC CCCCCACCAGTAGGTTCGCAAGAAGGCCCTAAAGATCCTGAAGCCTGGAGCAGGCCACAGGGTTGGTATA ATCATAGCGGGAAATAA |
Restriction Sites | Please inquire |
ACCN | NM_006871 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006871.2, NP_006862.2 |
RefSeq Size | 1940 bp |
RefSeq ORF | 1557 bp |
Locus ID | 11035 |
UniProt ID | Q9Y572 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Cytosolic DNA-sensing pathway |
Gene Summary | The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Mismatched effects of receptor interacting protein kinase-3 on hepatic steatosis and inflammation in non-alcoholic fatty liver disease
,null,
World Journal of Gastroenterology
,PubMed ID 30622377
[RIPK3]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209549 | RIPK3 (Myc-DDK-tagged)-Human receptor-interacting serine-threonine kinase 3 (RIPK3) |
CNY 5,784.00 |
|
RC209549L1 | Lenti ORF clone of Human receptor-interacting serine-threonine kinase 3 (RIPK3), Myc-DDK-tagged |
CNY 8,184.00 |
|
RC209549L2 | Lenti ORF clone of Human receptor-interacting serine-threonine kinase 3 (RIPK3), mGFP tagged |
CNY 5,890.00 |
|
RC209549L3 | Lenti ORF clone of Human receptor-interacting serine-threonine kinase 3 (RIPK3), Myc-DDK-tagged |
CNY 8,184.00 |
|
RC209549L4 | Lenti ORF clone of Human receptor-interacting serine-threonine kinase 3 (RIPK3), mGFP tagged |
CNY 8,184.00 |
|
RG209549 | RIPK3 (tGFP-tagged) - Human receptor-interacting serine-threonine kinase 3 (RIPK3) |
CNY 7,384.00 |