Lipophilin B (SCGB1D2) (NM_006551) Human Untagged Clone
CAT#: SC303787
SCGB1D2 (untagged)-Human secretoglobin, family 1D, member 2 (SCGB1D2)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LIPB; LPHB; LPNB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303787 representing NM_006551.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGCTGTCGGTGTGTCTCCTGCTGGTCACGCTGGCCCTCTGCTGCTACCAGGCCAATGCCGAGTTC TGCCCAGCTCTTGTTTCTGAGCTGTTAGACTTCTTCTTCATTAGTGAACCTCTGTTCAAGTTAAGTCTT GCCAAATTTGATGCCCCTCCGGAAGCTGTTGCAGCCAAGTTAGGAGTGAAGAGATGCACGGATCAGATG TCCCTTCAGAAACGAAGCCTCATTGCGGAAGTCCTGGTGAAAATATTGAAGAAATGTAGTGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006551 |
Insert Size | 273 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006551.3 |
RefSeq Size | 454 bp |
RefSeq ORF | 273 bp |
Locus ID | 10647 |
UniProt ID | O95969 |
Protein Families | Secreted Protein |
MW | 9.9 kDa |
Gene Summary | The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. Lipophilin gene products are widely expressed in normal tissues, especially in endocrine-responsive organs. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 10, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220905 | SCGB1D2 (Myc-DDK-tagged)-Human secretoglobin, family 1D, member 2 (SCGB1D2) |
CNY 1,200.00 |
|
RC220905L3 | Lenti ORF clone of Human secretoglobin, family 1D, member 2 (SCGB1D2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220905L4 | Lenti ORF clone of Human secretoglobin, family 1D, member 2 (SCGB1D2), mGFP tagged |
CNY 5,890.00 |
|
RG220905 | SCGB1D2 (tGFP-tagged) - Human secretoglobin, family 1D, member 2 (SCGB1D2) |
CNY 4,370.00 |
其它Lipophilin B产品