MCP3 (CCL7) (NM_006273) Human Untagged Clone
CAT#: SC303764
CCL7 (untagged)-Human chemokine (C-C motif) ligand 7 (CCL7)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FIC; MARC; MCP-3; MCP3; NC28; SCYA6; SCYA7 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_006273 edited
GCAGAGGGGCTGAGACCAAACCAGAAACCTCCAATTCTCATGTGGAAGCCCATGCCCTCA CCCTCCAACATGAAAGCCTCTGCAGCACTTCTGTGTCTGCTGCTCACAGCAGCTGCTTTC AGCCCCCAGGGGCTTGCTCAGCCAGTTGGGATTAATACTTCAACTACCTGCTGCTACAGA TTTATCAATAAGAAAATCCCTAAGCAGAGGCTGGAGAGCTACAGAAGGACCACCAGTAGC CACTGTCCCCGGGAAGCTGTAATCTTCAAGACCAAACTGGACAAGGAGATCTGTGCTGAC CCCACACAGAAGTGGGTCCAGGACTTTATGAAGCACCTGGACAAGAAAACCCAAACTCCA AAGCTTTGAACATTCATGACTGAACTGAAAACAAGCCATGACTTGAGAAACAAATAATTT GTATACCCTGTCCTTTCTCAGAGTGGTTCTGAGATTATTTTAATCTAATTCTAAGGAATA TGAGCTTTATGTAATAATGTGAATCATGGTTTTTCTTAGTAGATTTTAAAAGTTATTAAT ATTTTAATTTAATCTTCCATGGATTTTGGTGGGTTTTGAACATAAAGCCTTGGATGTATA TGTCATCTCAGTGCTGTAAAAACTGTGGGATGCTCCTCCCTTCTCTACCTCATGGGGGTA TTGTATAAGTCCTTGCAAGAATCAGTGCAAAGATTTGCTTTAATTGTTAAGATATGATGT CCCTATGGAAGCATATTGTTATTATATAATTACATATTTGCATATGTATGACTCCCAAAT TTTCACATAAAATAGATTTTTGTATAACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006273 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006273.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006273.2, NP_006264.2 |
RefSeq Size | 810 bp |
RefSeq ORF | 300 bp |
Locus ID | 6354 |
UniProt ID | P80098 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, NOD-like receptor signaling pathway |
Gene Summary | This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210469 | CCL7 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 7 (CCL7) |
CNY 1,200.00 |
|
RC210469L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 7 (CCL7), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210469L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 7 (CCL7), mGFP tagged |
CNY 5,890.00 |
|
RG210469 | CCL7 (tGFP-tagged) - Human chemokine (C-C motif) ligand 7 (CCL7) |
CNY 4,370.00 |