United States
Germany
Japan
United Kingdom
China
PROP1 (NM_006261) Human Untagged Clone
CAT＃: SC303762
PROP1 (untagged)-Human PROP paired-like homeobox 1 (PROP1)
CNY 3,840.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CPHD2; PROP-1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303762 representing NM_006261.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGCAGAAAGGAGGCGCCAGGCTGAGAAGCCAAAGAAGGGGCGAGTCGGCAGCAGCCTGTTGCCT GAGAGACACCCGGCCACTGGGACCCCGACCACCACGGTGGACTCGAGTGCTCCACCCTGCAGAAGGCTC CCTGGTGCAGGAGGGGGGAGATCAAGGTTCTCCCCGCAAGGAGGACAGAGGGGCCGCCCGCACTCCCGG CGCCGCCACCGCACCACCTTCAGCCCAGTGCAGTTGGAACAGCTGGAGTCAGCCTTTGGGAGGAACCAG TACCCCGACATCTGGGCCCGAGAGAGTCTTGCCCGGGACACTGGCCTCAGTGAGGCCCGAATCCAGGTC TGGTTCCAGAACCGCAGAGCTAAGCAACGGAAGCAAGAGCGCTCACTGCTTCAGCCTCTGGCCCATCTG TCTCCTGCCGCCTTTTCCAGCTTCTTGCCAGAGTCCACTGCTTGCCCCTATTCTTACGCAGCACCACCA CCACCAGTGACCTGCTTCCCTCACCCCTACAGCCATGCCCTCCCTTCCCAGCCCTCCACAGGAGGCGCC TTTGCTTTGTCACACCAGTCTGAGGACTGGTACCCTACCTTGCACCCAGCCCCTGCCGGCCATCTGCCC TGCCCCCCACCCCCTCCCATGCTCCCCCTCAGCCTTGAGCCATCCAAGTCCTGGAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_006261 |
| Insert Size | 681 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006261.4 |
| RefSeq Size | 1464 bp |
| RefSeq ORF | 681 bp |
| Locus ID | 5626 |
| UniProt ID | O75360 |
| Protein Families | Druggable Genome, Transcription Factors |
| MW | 25 kDa |
| Gene Summary | This gene encodes a paired-like homeodomain transcription factor in the developing pituitary gland. Expression occurs prior to and is required for expression of pou domain transcription factor 1, which is responsible for pituitary development and hormone expression. Mutations in this gene have been associated with combined pituitary hormone deficiency-2 as well as deficiencies in luteinizing hormone, follicle-stimulating hormone, growth hormone, prolactin, and thyroid-stimulating hormone. [provided by RefSeq, Sep 2011] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218746 | PROP1 (Myc-DDK-tagged)-Human PROP paired-like homeobox 1 (PROP1) |
CNY 3,600.00 |
|
| RC218746L3 | Lenti ORF clone of Human PROP paired-like homeobox 1 (PROP1), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC218746L4 | Lenti ORF clone of Human PROP paired-like homeobox 1 (PROP1), mGFP tagged |
CNY 5,890.00 |
|
| RG218746 | PROP1 (tGFP-tagged) - Human PROP paired-like homeobox 1 (PROP1) |
CNY 4,370.00 |
