BOB1 (POU2AF1) (NM_006235) Human Untagged Clone

CAT#: SC303755

POU2AF1 (untagged)-Human POU class 2 associating factor 1 (POU2AF1)



  "NM_006235" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
POU2AF1 mouse monoclonal antibody, clone OTI2D3 (formerly 2D3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BOB1; OBF-1; OBF1; OCAB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_006235, the custom clone sequence may differ by one or more nucleotides


ATGCTCTGGCAAAAACCCACAGCTCCGGAGCAAGCCCCAGCCCCGGCCCGGCCATACCAGGGCGTCCGTG
TGAAGGAGCCAGTGAAGGAACTGCTGAGGAGGAAGCGAGGCCACGCCAGCAGTGGGGCAGCACCTGCACC
TACGGCGGTGGTGCTGCCCCATCAGCCCCTGGCGACCTACACCACAGTGGGTCCTTCCTGCCTGGACATG
GAAGGTTCTGTGTCTGCAGTGACAGAGGAGGCTGCCCTGTGTGCCGGCTGGCTCTCCCAGCCCACCCCGG
CCACCCTGCAGCCCCTGGCCCCATGGACACCTTACACCGAGTATGTGCCCCATGAAGCTGTCAGCTGCCC
CTACTCAGCTGACATGTATGTGCAGCCCGTGTGCCCCAGCTACACGGTGGTGGGGCCCTCCTCAGTGTTG
ACCTATGCCTCTCCGCCACTCATCACCAATGTCACGACAAGAAGCTCCGCCACGCCCGCAGTGGGGCCCC
CGCTGGAGGGCCCAGAGCACCAGGCACCCCTCACCTATTTCCCGTGGCCTCAGCCCCTTTCCACACTACC
CACCTCCACCCTGCAGTACCAGCCTCCGGCCCCAGCCCTACCTGGGCCCCAGTTTGTCCAGCTCCCCATC
TCTATCCCAGAGCCAGTCCTTCAGGACATGGAAGACCCCAGAAGAGCCGCCAGCTCGTTGACCATCGACA
AGCTGCTTTTGGAGGAAGAGGATAGCGACGCCTATGCGCTTAACCACACTCTCTCTGTGGAAGGCTTTTA
G


Restriction Sites Please inquire     
ACCN NM_006235
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006235.1, NP_006226.1
RefSeq Size 3314 bp
RefSeq ORF 771 bp
Locus ID 5450
UniProt ID Q16633
Gene Summary Transcriptional coactivator that specifically associates with either OCT1 or OCT2. It boosts the OCT1 mediated promoter activity and to a lesser extent, that of OCT2. It has no intrinsic DNA-binding activity. It recognizes the POU domains of OCT1 and OCT2. It is essential for the response of B-cells to antigens and required for the formation of germinal centers.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...