United States
Germany
Japan
United Kingdom
China
FGF8 (NM_006119) Human Untagged Clone
CAT＃: SC303734
FGF8 (untagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AIGF; FGF-8; HBGF-8; HH6; KAL6 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_006119 edited
ACCCGCACCCTCTCCGCTCGCGCCCTGCTCAGCGCGTCCTCCCGCGGCGGCCCGCGGGAC GGCGTGACCCGCCGGGCTCTCGGTGCCCCGGGGCCGCGCGCCATGGGCAGCCCCCGCTCC GCGCTGATCTGCCTGCTGTTGCACTTGCTGGTCCTCTGCCTCCAAGCCCAGGTAACTGTT CAGTCCTCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACGGATCAGCTC AGCCGCCGCCTCATCCGGACCTACCAACTCTACAGCCGCACCAGCGGGAAGCACGTGCAG GTCCTGGCCAACAAGCGCATCAACGCCATGGCAGAGGACGGCGACCCCTTCGCAAAGCTC ATCGTGGAGACGGACACCTTTGGAAGCAGAGTTCGAGTCCGAGGAGCCGAGACGGGCCTC TACATCTGCATGAACAAGAAGGGGAAGCTGATCGCCAAGAGCAACGGCAAAGGCAAGGAC TGCGTCTTCACGGAGATTGTGCTGGAGAACAACTACACAGCGCTGCAGAATGCCAAGTAC GAGGGCTGGTACATGGCCTTCACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGACGCGG CAGCACCAGCGTGAGGCCCACTTCATGAAGCGGCTGCCCCGGGGCCACCACACCACCGAG CAGAGCCTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGC CAGAGGACTTGGGCCCCCGAGCCCCGATAGGTGCTGCCTGGCCCTCCCCACAATGCCAGA CCGCAGAGAGGCTCATCCTGTAGGGCACCCAAAACTCAAGCAAGATGAGCTGTGCGCTGC TCTGCAGGCTGGGGAGGTGCTGGGGGAGCCCTGGGTTCCGGTTGTTGATA |
| Restriction Sites | Please inquire |
| ACCN | NM_006119 |
| Insert Size | 900 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006119.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006119.2, NP_006110.1 |
| RefSeq Size | 1020 bp |
| RefSeq ORF | 648 bp |
| Locus ID | 2253 |
| UniProt ID | P55075 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (B) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (B) is shorter than isoform F. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214620 | FGF8 (Myc-DDK-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B |
CNY 3,600.00 |
|
| RC214620L1 | Lenti-ORF clone of FGF8 (Myc-DDK-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B |
CNY 6,000.00 |
|
| RC214620L2 | Lenti-ORF clone of FGF8 (mGFP-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B |
CNY 6,000.00 |
|
| RC214620L3 | Lenti-ORF clone of FGF8 (Myc-DDK-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B |
CNY 5,890.00 |
|
| RC214620L4 | Lenti-ORF clone of FGF8 (mGFP-tagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B |
CNY 5,890.00 |
|
| RG214620 | FGF8 (tGFP-tagged) - Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B |
CNY 4,370.00 |
