MOCS1 (NM_005943) Human Untagged Clone
CAT#: SC303709
MOCS1 (untagged)-Human molybdenum cofactor synthesis 1 (MOCS1), transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MIG11; MOCOD; MOCS1A; MOCS1B |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_005943, the custom clone sequence may differ by one or more nucleotides
ATGTGGAAGAGTTGGAAGCTCCGCACAGATGTCAGAGTAAGGGAGGGGGCAGGCGGTTCT CCTTGTGCCTCTTCCCAGCCCGGTAGCAGGGGCCCATGCTTCCTCCCTGGTCTGTCCTCG CAGGAGGTGTCCAGGCGGAGGCAGTTCCTGCGGGAGCATGCGGCCCCCTTCTCCGCCTTC CTCACAGACAGCTTCGGCCGGCAGCACAGCTACCTGCGGATCTCCCTCACAGAGAAGTGC AACCTCAGATGTCAGTACTGCATGCCCGAGGAGGGGGTCCCGCTGACCCCCAAAGCCAAC CTGCTGACCACAGAGGAGATCCTGACCCTCGCCCGGCTCTTTGTGAAGGAAGGCATCGAC AAGATCCGGCTCACAGGTGGAGAGCCGCTTATCCGGCCGGACGTGGTGGACATTGTGGCC CAGCTCCAGCGGCTGGAAGGGCTGAGAACCATAGGTGTTACCACCAATGGCATCAACCTG GCCCGGCTACTGCCCCAGCTTCAGAAGGCTGGTCTCAGTGCCATCAACATCAGCCTGGAC ACCCTGGTGCCTGCCAAGTTTGAGTTCATTGTCCGCAGGAAAGGCTTCCACAAGGTCATG GAGGGCATCCACAAGGCCATCGAGCTGGGCTACAACCCTGTGAAGGTGAACTGTGTGGTG ATGCGAGGCCTTAACGAGGATGAACTCCTGGACTTTGCGGCCTTGACTGAGGGCCTCCCC CTGGATGTGCGCTTCATAGAGTATATGCCCTTTGATGGCAACAAGTGGAACTTCAAGAAG ATGGTCAGCTATAAGGAGATGCTAGACACTGTCCGGCAGCAGTGGCCAGAGCTGGAGAAG GTGCCAGAGGAGGAATCCAGCACAGCCAAGGCCTTTAAAATCCCTGGCTTCCAAGGCCAG ATCAGCTTCATCACATCCATGTCTGAGCATTTCTGTGGGACCTGCAACCGCCTGCGAATC ACAGCTGATGGGAACCTCAAGGTCTGCCTCTTTGGAAACTCTGAGGTATCCCTGCGGGAT CACCTGCGAGCTGGGGCCTCTGAGCAGGAGCTGCTGAGAATCATTGGGGCTGCTGTGGGC AGGAAGAAGCGGCAGCATGCAGGCATGTTCAGTATTTCCCAGATGAAGAACCGGCCCATG ATCCTCATCGGTGGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_005943 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005943.2, NP_005934.2 |
RefSeq Size | 2896 bp |
RefSeq ORF | 1158 bp |
Locus ID | 4337 |
UniProt ID | Q9NZB8 |
Gene Summary | Molybdenum cofactor biosynthesis is a conserved pathway leading to the biological activation of molybdenum. The protein encoded by this gene is involved in this pathway. This gene was originally thought to produce a bicistronic mRNA with the potential to produce two proteins (MOCS1A and MOCS1B) from adjacent open reading frames. However, only the first open reading frame (MOCS1A) has been found to encode a protein from the putative bicistronic mRNA, whereas additional splice variants are likely to produce a fusion between the two open reading frames. This gene is defective in patients with molybdenum cofactor deficiency, type A. A related pseudogene has been identified on chromosome 16. [provided by RefSeq, Nov 2017] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224351 | MOCS1 (Myc-DDK-tagged)-Human molybdenum cofactor synthesis 1 (MOCS1), transcript variant 1 |
CNY 3,990.00 |
|
RC224351L3 | Lenti-ORF clone of MOCS1 (Myc-DDK-tagged)-Human molybdenum cofactor synthesis 1 (MOCS1), transcript variant 1 |
CNY 5,890.00 |
|
RC224351L4 | Lenti-ORF clone of MOCS1 (mGFP-tagged)-Human molybdenum cofactor synthesis 1 (MOCS1), transcript variant 1 |
CNY 5,890.00 |
|
RG224351 | MOCS1 (tGFP-tagged) - Human molybdenum cofactor synthesis 1 (MOCS1), transcript variant 1 |
CNY 4,370.00 |