United States
Germany
Japan
United Kingdom
China
KLRG1 (NM_005810) Human Untagged Clone
CAT＃: SC303694
KLRG1 (untagged)-Human killer cell lectin-like receptor subfamily G, member 1 (KLRG1)
CNY 2,640.00
CNY 3,990.00
Product images
CNY 6,281.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2F1; CLEC15A; MAFA; MAFA-2F1; MAFA-L; MAFA-LIKE |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303694 representing NM_005810.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTGACAGTGTTATTTATTCCATGTTAGAGTTGCCTACGGCAACCCAAGCCCAGAATGACTATGGA CCACAGCAAAAATCTTCCTCTTCCAGGCCTTCTTGTTCTTGCCTTGTGGCAATAGCTTTGGGGCTTCTG ACTGCAGTTCTTCTGAGTGTGCTGCTATACCAGTGGATCCTGTGCCAGGGCTCCAACTACTCCACTTGT GCCAGCTGTCCTAGCTGCCCAGACCGCTGGATGAAATATGGTAACCATTGTTATTATTTCTCAGTGGAG GAAAAGGACTGGAATTCTAGTCTGGAATTCTGCCTAGCCAGAGACTCACACCTCCTTGTGATAACGGAC AATCAGGAAATGAGCCTGCTCCAAGTTTTCCTCAGTGAGGCCTTTTGCTGGATTGGTCTGAGGAACAAT TCTGGCTGGAGGTGGGAAGATGGATCACCTCTAAACTTCTCAAGGATTTCTTCTAATAGCTTTGTGCAG ACATGCGGTGCCATCAACAAAAATGGTCTTCAAGCCTCAAGCTGTGAAGTTCCTTTACACTGGGTGTGT AAGAAGGTCAGACTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_005810 |
| Insert Size | 570 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_005810.3 |
| RefSeq Size | 1815 bp |
| RefSeq ORF | 570 bp |
| Locus ID | 10219 |
| UniProt ID | Q96E93 |
| Protein Families | Transmembrane |
| MW | 21.2 kDa |
| Gene Summary | Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor (KLR) family, which is a group of transmembrane proteins preferentially expressed in NK cells. Studies in mice suggested that the expression of this gene may be regulated by MHC class I molecules. [provided by RefSeq, Jun 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219705 | KLRG1 (Myc-DDK-tagged)-Human killer cell lectin-like receptor subfamily G, member 1 (KLRG1) |
CNY 2,400.00 |
|
| RC219705L1 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily G, member 1 (KLRG1), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC219705L2 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily G, member 1 (KLRG1), mGFP tagged |
CNY 5,890.00 |
|
| RC219705L3 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily G, member 1 (KLRG1), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC219705L4 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily G, member 1 (KLRG1), mGFP tagged |
CNY 4,800.00 |
|
| RG219705 | KLRG1 (tGFP-tagged) - Human killer cell lectin-like receptor subfamily G, member 1 (KLRG1) |
CNY 4,370.00 |
