TECK (CCL25) (NM_005624) Human Untagged Clone
CAT#: SC303672
CCL25 (untagged)-Human chemokine (C-C motif) ligand 25 (CCL25), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Ckb15; Ck beta-15; SCYA25; TECK |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303672 representing NM_005624.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACCTGTGGCTCCTGGCCTGCCTGGTGGCCGGCTTCCTGGGAGCCTGGGCCCCCGCTGTCCACACC CAAGGTGTCTTTGAGGACTGCTGCCTGGCCTACCACTACCCCATTGGGTGGGCTGTGCTCCGGCGCGCC TGGACTTACCGGATCCAGGAGGTGAGCGGGAGCTGCAATCTGCCTGCTGCGATATTCTACCTCCCCAAG AGACACAGGAAGGTGTGTGGGAACCCCAAAAGCAGGGAGGTGCAGAGAGCCATGAAGCTCCTGGATGCT CGAAATAAGGTTTTTGCAAAGCTCCACCACAACACGCAGACCTTCCAAGCAGGCCCTCATGCTGTAAAG AAGTTGAGTTCTGGAAACTCCAAGTTATCATCGTCCAAGTTTAGCAATCCCATCAGCAGCAGTAAGAGG AATGTCTCCCTCCTGATATCAGCTAATTCAGGACTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_005624 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005624.3 |
RefSeq Size | 1002 bp |
RefSeq ORF | 453 bp |
Locus ID | 6370 |
UniProt ID | O15444 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
MW | 16.6 kDa |
Gene Summary | This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222128 | CCL25 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 25 (CCL25), transcript variant 1 |
CNY 1,200.00 |
|
RC222128L1 | Lenti ORF clone of Human chemokine (C-C motif) ligand 25 (CCL25), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222128L2 | Lenti ORF clone of Human chemokine (C-C motif) ligand 25 (CCL25), transcript variant 1, mGFP tagged |
CNY 3,600.00 |
|
RC222128L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 25 (CCL25), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222128L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 25 (CCL25), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG222128 | CCL25 (tGFP-tagged) - Human chemokine (C-C motif) ligand 25 (CCL25), transcript variant 1 |
CNY 2,800.00 |