TAL2 (NM_005421) Human Untagged Clone

CAT#: SC303640

TAL2 (untagged)-Human T-cell acute lymphocytic leukemia 2 (TAL2)



  "NM_005421" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-TAL2 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005421 edited
CCCTGAGGGCCCTTTCTCTTTCCATCTCAGGAACTCAAACATGACCAGGAAGATCTTCAC
AAATACCAGGGAGCGGTGGAGGCAGCAGAATGTCAACAGCGCCTTTGCCAAGCTGAGGAA
GCTCATCCCCACTCACCCTCCAGACAAAAAGCTGAGCAAAAATGAAACGCTTCGCCTGGC
AATGAGGTATATCAACTTCTTGGTCAAGGTCTTGGGGGAGCAAAGCCTGCAACAAACGGG
AGTGGCTGCTCAGGGGAACATTCTGGGGCTCTTCCCTCAAGGACCCCACCTGCCAGGCCT
GGAGGACAGAACTCTGCTTGAGAACTACCAGGTTCCTTCACCTGGTCCAAGCCACCACAT
TCCTTAGTGTGGCTCTGGCTGTCATCTCC
Restriction Sites Please inquire     
ACCN NM_005421
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005421.1, NP_005412.1
RefSeq Size 327 bp
RefSeq ORF 327 bp
Locus ID 6887
UniProt ID Q16559
Protein Families Druggable Genome
Gene Summary This intronless gene encodes a helix-loop-helix protein. Translocations between this gene on chromosome 9 and the T-cell receptor beta-chain locus on chromosome 7 have been associated with activation of the T-cell acute lymphocytic leukemia 2 gene and T-cell acute lymphoblastic leukemia. [provided by RefSeq, Mar 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...