TAL2 (NM_005421) Human Untagged Clone
CAT#: SC303640
TAL2 (untagged)-Human T-cell acute lymphocytic leukemia 2 (TAL2)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_005421 edited
CCCTGAGGGCCCTTTCTCTTTCCATCTCAGGAACTCAAACATGACCAGGAAGATCTTCAC AAATACCAGGGAGCGGTGGAGGCAGCAGAATGTCAACAGCGCCTTTGCCAAGCTGAGGAA GCTCATCCCCACTCACCCTCCAGACAAAAAGCTGAGCAAAAATGAAACGCTTCGCCTGGC AATGAGGTATATCAACTTCTTGGTCAAGGTCTTGGGGGAGCAAAGCCTGCAACAAACGGG AGTGGCTGCTCAGGGGAACATTCTGGGGCTCTTCCCTCAAGGACCCCACCTGCCAGGCCT GGAGGACAGAACTCTGCTTGAGAACTACCAGGTTCCTTCACCTGGTCCAAGCCACCACAT TCCTTAGTGTGGCTCTGGCTGTCATCTCC |
Restriction Sites | Please inquire |
ACCN | NM_005421 |
Insert Size | 400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005421.1, NP_005412.1 |
RefSeq Size | 327 bp |
RefSeq ORF | 327 bp |
Locus ID | 6887 |
UniProt ID | Q16559 |
Protein Families | Druggable Genome |
Gene Summary | This intronless gene encodes a helix-loop-helix protein. Translocations between this gene on chromosome 9 and the T-cell receptor beta-chain locus on chromosome 7 have been associated with activation of the T-cell acute lymphocytic leukemia 2 gene and T-cell acute lymphoblastic leukemia. [provided by RefSeq, Mar 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224692 | TAL2 (Myc-DDK-tagged)-Human T-cell acute lymphocytic leukemia 2 (TAL2) |
CNY 1,200.00 |
|
RC224692L3 | Lenti ORF clone of Human T-cell acute lymphocytic leukemia 2 (TAL2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224692L4 | Lenti ORF clone of Human T-cell acute lymphocytic leukemia 2 (TAL2), mGFP tagged |
CNY 5,890.00 |
|
RG224692 | TAL2 (tGFP-tagged) - Human T-cell acute lymphocytic leukemia 2 (TAL2) |
CNY 2,800.00 |