GSC2 (NM_005315) Human Untagged Clone
CAT#: SC303614
GSC2 (untagged)-Human goosecoid homeobox 2 (GSC2)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GSCL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303614 representing NM_005315.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCAGCGGCTGGGGGCGCGGCGAGCCGCCGGGGTGCCGGGCGGCCCTGCCCCTTCTCCATCGAG CACATCCTCTCCAGCCTGCCCGAGCGGAGCCTCCCGGCCCGGGCCGCCTGCCCACCGCAGCCCGCCGGT CGCCAGAGCCCCGCGAAGCCAGAGGAGCCCGGGGCGCCCGAGGCTGCGCCCTGCGCCTGCTGCTGCTGC TGCGGCCCCCGCGCGGCGCCCTGCGGGCCCCCAGAGGCGGCCGCCGGGCTGGGCGCTCGTCTGGCGTGG CCGCTGAGGCTGGGACCGGCGGTGCCCTTGTCTCTGGGTGCGCCAGCCGGAGGTTCCGGGGCGCTCCCG GGCGCGGTCGGCCCGGGTTCGCAGCGGCGCACGAGGCGCCACCGCACCATCTTCAGCGAAGAGCAGCTG CAGGCGCTCGAGGCGCTTTTCGTGCAGAACCAGTATCCTGACGTGAGTACGCGCGAGCGCCTGGCCGGC CGCATCCGCCTTCGCGAGGAGCGCGTGGAGGTCTGGTTCAAGAACCGCCGGGCCAAATGGCGACACCAG AAGCGCGCGTCGGCTTCCGCGAGGCTCCTGCCCGGCGTCAAGAAGTCCCCGAAGGGGAGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_005315 |
Insert Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005315.1 |
RefSeq Size | 618 bp |
RefSeq ORF | 618 bp |
Locus ID | 2928 |
UniProt ID | O15499 |
MW | 21.5 kDa |
Gene Summary | Goosecoidlike (GSCL), a homeodomain-containing gene, resides in the critical region for VCFS/DGS on 22q11. Velocardiofacial syndrome (VCFS) is a developmental disorder characterized by conotruncal heart defects, craniofacial anomalies, and learning disabilities. VCFS is phenotypically related to DiGeorge syndrome (DGS) and both syndromes are associated with hemizygous 22q11 deletions. Because many of the tissues and structures affected in VCFS/DGS derive from the pharyngeal arches of the developing embryo, it is believed that haploinsufficiency of a gene involved in embryonic development may be responsible for its etiology. The gene is expressed in a limited number of adult tissues, as well as in early human development. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218631 | GSC2 (Myc-DDK-tagged)-Human goosecoid homeobox 2 (GSC2) |
CNY 2,400.00 |
|
RC218631L3 | Lenti ORF clone of Human goosecoid homeobox 2 (GSC2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218631L4 | Lenti ORF clone of Human goosecoid homeobox 2 (GSC2), mGFP tagged |
CNY 5,890.00 |
|
RG218631 | GSC2 (tGFP-tagged) - Human goosecoid homeobox 2 (GSC2) |
CNY 4,370.00 |