Rapsyn (RAPSN) (NM_005055) Human Untagged Clone
CAT#: SC303569
RAPSN (untagged)-Human receptor-associated protein of the synapse (RAPSN), transcript variant 1
CNY 6,650.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CMS4C; CMS11; FADS; FADS2; RAPSYN; RNF205 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_005055 edited
ATGGGGCAGGACCAGACCAAGAAGCAGATCGAGAAGGGGCTCCAGCTGTACCAGTCCAAC CAGACAGAGAAGGCATTGCAGGTGTGGACAAAGGTGCTGGAGAAGAGCTCGGACCTCATG GGGCGCTTCCGCGTGCTGGGCTGCCTGGTCACAGCCCACTCGGAGATGGGCCGCTACAAG GAGATGCTGAAGTTCGCTGTGGTCCAGATCGACACGGCCCGGGAGCTGGAGGATGCCGAC TTCCTCCTGGAGAGCTACCTGAACCTGGCACGCAGCAACGAGAAGCTGTGCGAGTTTCAC AAGACCATCTCCTACTGCAAGACCTGCCTTGGGCTGCCTGGTACCAGGGCAGGTGCCCAG CTCGGAGGCCAGGTCAGCCTGAGCATGGGCAATGCCTTCCTGGGCCTCAGCGTCTTCCAG AAGGCCCTGGAGAGCTTCGAGAAGGCCCTGCGCTATGCCCACAACAATGATGACGCCATG CTCGAGTGCCGCGTGTGCTGCAGCCTGGGCAGCTTCTATGCCCAGGTCAAGGACTACGAG AAAGCCCTGTTCTTCCCCTGCAAGGCGGCAGAGCTTGTCAACAACTATGGCAAAGGCTGG AGCCTGAAGTACCGGGCCATGAGCCAGTACCACATGGCCGTGGCCTATCGCCTGCTGGGC CGCCTGGGCAGTGCCATGGAGTGTTGTGAGGAGTCTATGAAGATCGCGCTGCAGCACGGG GACCGGCCACTGCAGGCGCTCTGCCTGCTCTGCTTCGCTGACATCCACCGGAGCCGTGGG GACCTGGAGACAGCCTTCCCCAGGTACGACTCCGCCATGAGCATCATGACCGAGATCGGA AACCGCCTGGGGCAGGTGCAGGCGCTGCTGGGTGTGGCCAAGTGCTGGGTGGCCAGGAAG GCGCTGGACAAGGCTCTGGATGCCATCGAGAGAGCCCAGGATCTGGCCGAGGAGGTGGGG AACAAGCTGAGCCAGCTCAAGCTGCACTGTCTGAGCGAGAGCATTTACCGCAGCAAAGGG CTGCAGCGGGAACTGCGGGCGCACGTTGTGAGGTTCCACGAGTGCGTGGAGGAGACGGAG CTCTACTGCGGCCTGTGCGGCGAGTCCATAGGCGAGAAGAACAGCCGGCTGCAGGCCCTA CCTTGCTCCCACATCTTCCACCTCAGGTGCCTGCAGAACAACGGGACCCGGAGCTGTCCC AACTGCCGCCGCTCATCCATGAAGCCTGGCTTTGTATGA |
Restriction Sites | Please inquire |
ACCN | NM_005055 |
Insert Size | 1239 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone was fully sequenced and its ORF matches with NM_005055.3. There is a SNP in the ORF. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005055.3, NP_005046.2 |
RefSeq Size | 1664 bp |
RefSeq ORF | 1239 bp |
Locus ID | 5913 |
UniProt ID | Q13702 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222710 | RAPSN (Myc-DDK-tagged)-Human receptor-associated protein of the synapse (RAPSN), transcript variant 1 |
CNY 3,656.00 |
|
RC222710L1 | Lenti ORF clone of Human receptor-associated protein of the synapse (RAPSN), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC222710L2 | Lenti ORF clone of Human receptor-associated protein of the synapse (RAPSN), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC222710L3 | Lenti ORF clone of Human receptor-associated protein of the synapse (RAPSN), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222710L4 | Lenti ORF clone of Human receptor-associated protein of the synapse (RAPSN), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG222710 | RAPSN (tGFP-tagged) - Human receptor-associated protein of the synapse (RAPSN), transcript variant 1 |
CNY 5,256.00 |