BD2 (DEFB4A) (NM_004942) Human Untagged Clone

CAT#: SC303551

DEFB4A (untagged)-Human defensin, beta 4A (DEFB4A)



  "NM_004942" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DEFB4A Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BD-2; DEFB-2; DEFB2; DEFB4; DEFB102; HBD-2; SAP1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004942 edited
TGGTGAAGCTCCCAGCCATCAGCCATGAGGGTCTTGTATCTCCTCTTCTCGTTCCTCTTC
ATATTCCTGATGCCTCTTCCAGGTGTTTTTGGTGGTATAGGCGATCCTGTTACCTGCCTT
AAGAGTGGAGCCATATGTCATCCAGTCTTTTGCCCTAGAAGGTATAAACAAATTGGCACC
TGTGGTCTCCCTGGAACAAAATGCTGCAAAAAGCCATGAGGAGGCCAAGAAGCTGCTGTG
GCTGATGCGGATT
Restriction Sites Please inquire     
ACCN NM_004942
Insert Size 250 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_004942.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004942.2, NP_004933.1
RefSeq Size 336 bp
RefSeq ORF 195 bp
Locus ID 1673
UniProt ID O15263
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Gene Summary Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 4, an antibiotic peptide which is locally regulated by inflammation. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...