United States
Germany
Japan
United Kingdom
China
Neurturin (NRTN) (NM_004558) Human Untagged Clone
CAT＃: SC303499
NRTN (untagged)-Human neurturin (NRTN)
CNY 2,400.00
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NTN |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_004558 edited
ATGCAGCGCTGGAAGGCGGCGGCCTTGGCCTCAGTGCTCTGCAGCTCCGTGCTGTCCATC TGGATGTGTCGAGAGGGCCTGCTTCTCAGCCACCGCCTCGGACCTGCGCTGGTCCCCCTG CACCGCCTGCCTCGAACCCTGGACGCCCGGATTGCCCGCCTGGCCCAGTACCGTGCACTC CTGCAGGGGGCCCCGGATGCGATGGAGCTGCGCGAGCTGACGCCCTGGGCTGGGCGGCCC CCAGGTCCGCGCCGTCGGGCGGGGCCCCGGCGGCGGCGCGCGCGTGCGCGGTTGGGGGCG CGGCCTTGCGGGCTGCGCGAGCTGGAGGTGCGCGTGAGCGAGCTGGGCCTGGGCTACGCG TCCGACGAGACGGTGCTGTTCCGCTACTGCGCAGGCGCCTGCGAGGCTGCCGCGCGCGTC TACGACCTCGGGCTGCGACGACTGCGCCAGCGGCGGCGCCTGCGGCGGGAGCGGGTGCGC GCGCAGCCCTGCTGCCGCCCGACGGCCTACGAGGACGAGGTGTCCTTCCTGGACGCGCAC AGCCGCTACCACACGGTGCACGAGCTGTCGGCGCGCGAGTGCGCCTGCGTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_004558 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004558.2, NP_004549.1 |
| RefSeq Size | 1159 bp |
| RefSeq ORF | 594 bp |
| Locus ID | 4902 |
| UniProt ID | Q99748 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. A neurturin mutation has been described in a family with Hirschsprung Disease. [provided by RefSeq, Aug 2016] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Neurturin Gene Therapy Protects Parasympathetic Function to Prevent Irradiation-Induced Murine Salivary Gland Hypofunction
,Ferreira, JNA;Zheng, C;Lombaert, IMA;Goldsmith, CM;Cotrim, AP;Symonds, JM;Patel, VN;Hoffman, MP;,
Mol Ther Methods Clin Dev
,PubMed ID 29560384
[NRTN]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214513 | NRTN (Myc-DDK-tagged)-Human neurturin (NRTN) |
CNY 3,600.00 |
|
| RC214513L3 | Lenti-ORF clone of NRTN (Myc-DDK-tagged)-Human neurturin (NRTN) |
CNY 5,890.00 |
|
| RC214513L4 | Lenti-ORF clone of NRTN (mGFP-tagged)-Human neurturin (NRTN) |
CNY 5,890.00 |
|
| RG214513 | NRTN (tGFP-tagged) - Human neurturin (NRTN) |
CNY 5,200.00 |
其它Neurturin产品
