ART1 (NM_004314) Human Untagged Clone

CAT#: SC303465

ART1 (untagged)-Human ADP-ribosyltransferase 1 (ART1)



  "NM_004314" in other vectors (6)

CNY 6,270.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
ART1 mouse monoclonal antibody, clone OTI6E2 (formerly 6E2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ART2; ARTC1; CD296; RT6
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_004314 edited
ATGCAGATGCCTGCTATGATGTCTCTGCTTCTTGTGTCTGTGGGCCTCATGGAAGCACTT
CAGGCCCAGAGCCACCCCATCACACGACGAGACCTCTTCTCTCAAGAGATTCAGCTGGAC
ATGGCCCTGGCCTCCTTTGATGACCAGTACGCTGGCTGTGCTGCTGCCATGACAGCTGCT
CTCCCGGATCTCAACCACACGGAGTTCCAGGCCAACCAGGTGTATGCAGACAGCTGGACA
CTGGCAAGCAGCCAATGGCAGGAGCGTCAGGCCAGGTGGCCAGAGTGGAGTCTCAGCCCC
ACCCGTCCATCCCCGCCACCCCTGGGCTTCCGCGATGAGCATGGGGTGGCCCTCCTGGCC
TACACAGCCAACAGCCCCCTGCACAAGGAGTTCAATGCAGCCGTGCGTGAGGCGGGCCGC
TCCCGGGCCCACTACCTCCACCACTTCTCCTTCAAGACACTCCATTTCCTGCTGACTGAG
GCCCTGCAGCTCCTGGGCAGCGGCCAGCGTCCACCCCGGTGCCACCAGGTGTTCCGAGGT
GTGCACGGCCTGCGCTTCCGGCCAGCAGGGCCCCGGGCCACCGTGAGGCTGGGGGGCTTT
GCTTCTGCCTCCCTGAAGCATGTTGCAGCCCAGCAGTTTGGTGAGGACACCTTCTTCGGC
ATCTGGACCTGCCTTGGGGCCCCTATCAAGGGCTACTCCTTCTTCCCTGGAGAGGAAGAG
GTGCTGATCCCCCCCTTTGAGACCTTCCAAGTGATCAATGCCAGCAGACTGGCCCAGGGC
CCCGCCCGCATCTACCTCCGAGCCCTGGGCAAGCACAGCACCTACAACTGCGAGTACATC
AAAGACAAGAAGTGCAAGTCTGGGCCTTGCCATCTGGATAATTCAGCCATGGGTCAGAGC
CCCCTCTCTGCAGTCTGGTCTTTGCTGCTGCTGCTCTGGTTCCTCGTGGTGAGGGCCTTT
CCAGATGGTCCAGGCCTCCTTTGA
Restriction Sites Please inquire     
ACCN NM_004314
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF of NM_004314.1 at 769bp, changing the protein from Pro-->Leu. OriGene considers this to be a polymorphism and to reflect the natural differences between individuals.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004314.1, NP_004305.1
RefSeq Size 1334 bp
RefSeq ORF 984 bp
Locus ID 417
UniProt ID P52961
Gene Summary ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...