EBAG9 (NM_004215) Human Untagged Clone

CAT#: SC303455

EBAG9 (untagged)-Human estrogen receptor binding site associated, antigen, 9 (EBAG9), transcript variant 1



  "NM_004215" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Polyclonal Antibody against EBAG9
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EB9; PDAF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303455 representing NM_004215.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCATCACCCAGTTTCGGTTATTTAAATTTTGTACCTGCCTAGCAACAGTATTCTCATTCCTAAAG
AGATTAATATGCAGATCTGGCAGAGGACGGAAATTAAGTGGAGACCAAATAACTTTGCCAACTACAGTT
GATTATTCATCAGTTCCTAAGCAGACAGATGTTGAAGAGTGGACTTCCTGGGATGAAGATGCACCCACC
AGTGTAAAGATCGAAGGAGGGAATGGGAATGTGGCAACACAACAAAATTCTTTGGAACAACTGGAACCT
GACTATTTTAAGGACATGACACCAACTATTAGGAAAACTCAGAAAATTGTTATTAAGAAGAGAGAACCA
TTGAATTTTGGCATCCCAGATGGGAGCACAGGTTTCTCTAGTAGATTAGCAGCTACACAAGATCTGCCT
TTTATTCATCAGTCTTCTGAATTAGGTGACTTAGATACCTGGCAGGAAAATACCAATGCATGGGAAGAA
GAAGAAGATGCAGCCTGGCAAGCAGAAGAAGTTCTGAGACAGCAGAAACTAGCAGACAGAGAAAAGAGA
GCAGCCGAACAACAAAGGAAGAAAATGGAAAAGGAAGCACAACGGCTAATGAAGAAGGAACAAAACAAA
ATTGGTGTGAAACTTTCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004215
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004215.4
RefSeq Size 2495 bp
RefSeq ORF 642 bp
Locus ID 9166
UniProt ID O00559
Protein Families Druggable Genome
MW 24.4 kDa
Gene Summary This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...