United States
Germany
Japan
United Kingdom
China
GIP (NM_004123) Human Untagged Clone
CAT＃: SC303436
GIP (untagged)-Human gastric inhibitory polypeptide (GIP)
CNY 1,200.00
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_004123 edited
AGGCTCAGAAGGTCCAGAAATCAGGGGAAGGAGACCCCTATCTGTCCTTCTTCTGGAAGA GCTGGAAAGGAAGTCTGCTCAGGAAATAACCTTGGAAGATGGTGGCCACGAAGACCTTTG CTCTGCTGCTGCTGTCCCTGTTCCTGGCAGTGGGACTAGGAGAGAAGAAAGAGGGTCACT TCAGCGCTCTCCCCTCCCTGCCTGTTGGATCTCATGCTAAGGTGAGCAGCCCTCAACCTC GAGGCCCCAGGTACGCGGAAGGGACTTTCATCAGTGACTACAGTATTGCCATGGACAAGA TTCACCAACAAGACTTTGTGAACTGGCTGCTGGCCCAAAAGGGGAAGAAGAATGACTGGA AACACAACATCACCCAGAGGGAGGCTCGGGCGCTGGAGCTGGCCGGTCAAGCTAATAGGA AGGAGGAGGAGGCAGTGGAGCCACAGAGCTCCCCAGCCAAGAACCCCAGCGATGAAGATT TGCTGCGGGACTTGCTGATTCAAGAGCTGTTGGCCTGCTTGCTGGATCAGACAAACCTCT GCAGGCTCAGGTCTCGGTGACTCTGACCACACCCAGCTCAGGACTGGATTCTGCCCTTCA CTTAGCACCTGCCTCAGCCCCACTCCAGAATAGCCAAGAGAACCCAAACCAATAAAGTTT ATGCTAAGTCGAGCCCATTGTGAAAATTTATTAAAATGACTACTGAGCACT |
| Restriction Sites | Please inquire |
| ACCN | NM_004123 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_004123.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004123.2, NP_004114.1 |
| RefSeq Size | 711 bp |
| RefSeq ORF | 462 bp |
| Locus ID | 2695 |
| UniProt ID | P09681 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | This gene encodes an incretin hormone and belongs to the glucagon superfamily. The encoded protein is important in maintaining glucose homeostasis as it is a potent stimulator of insulin secretion from pancreatic beta-cells following food ingestion and nutrient absorption. This gene stimulates insulin secretion via its G protein-coupled receptor activation of adenylyl cyclase and other signal transduction pathways. It is a relatively poor inhibitor of gastric acid secretion. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Adaptive selection of an incretin gene in Eurasian populations
,Chia Lin Chang, James J. Cai, Chiening Lo, Jorge Amigo, Jae-Il Park, and Sheau Yu Teddy Hsu,
Genome Res., Jan 2011; 21: 21 - 32
[GIP]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222456 | GIP (Myc-DDK-tagged)-Human gastric inhibitory polypeptide (GIP) |
CNY 1,200.00 |
|
| RC222456L1 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC222456L2 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), mGFP tagged |
CNY 5,890.00 |
|
| RC222456L3 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222456L4 | Lenti ORF clone of Human gastric inhibitory polypeptide (GIP), mGFP tagged |
CNY 5,890.00 |
|
| RG222456 | GIP (tGFP-tagged) - Human gastric inhibitory polypeptide (GIP) |
CNY 2,800.00 |
