United States
Germany
Japan
United Kingdom
China
S100G (NM_004057) Human Untagged Clone
CAT＃: SC303426
S100G (untagged)-Human S100 calcium binding protein G (S100G)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CABP; CABP1; CABP9K; CALB3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_004057 edited
TTGGGCAACCAGACACCAGAATGAGTACTAAAAAGTCTCCTGAGGAACTGAAGAGGATTT TTGAAAAATATGCAGCCAAAGAAGGTGATCCAGACCAGTTGTCAAAGGATGAACTGAAGC TATTGATTCAGGCTGAATTCCCCAGTTTACTCAAAGGTCCAAACACCCTAGATGATCTCT TTCAAGAACTGGACAAGAATGGAGATGGAGAAGTTAGTTTTGAAGAATTCCAAGTATTAG TAAAAAAGATATCCCAGTGAAGAAGAAAACAAAATAGAACCCTGAGCACTGGAGGAAGAG CGCCTGTGC |
| Restriction Sites | Please inquire |
| ACCN | NM_004057 |
| Insert Size | 300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_004057.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004057.1, NP_004048.1 |
| RefSeq Size | 456 bp |
| RefSeq ORF | 240 bp |
| Locus ID | 795 |
| UniProt ID | P29377 |
| Gene Summary | This gene encodes calbindin D9K, a vitamin D-dependent calcium-binding protein. This cytosolic protein belongs to a family of calcium-binding proteins that includes calmodulin, parvalbumin, troponin C, and S100 protein. In the intestine, the protein is vitamin D-dependent and its expression correlates with calcium transport activity. The protein may increase Ca2+ absorption by buffering Ca2+ in the cytoplasm and increase ATP-dependent Ca2+ transport in duodenal basolateral membrane vesicles. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211347 | S100G (Myc-DDK-tagged)-Human S100 calcium binding protein G (S100G) |
CNY 1,200.00 |
|
| RC211347L1 | Lenti ORF clone of Human S100 calcium binding protein G (S100G), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC211347L2 | Lenti ORF clone of Human S100 calcium binding protein G (S100G), mGFP tagged |
CNY 5,890.00 |
|
| RC211347L3 | Lenti ORF clone of Human S100 calcium binding protein G (S100G), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC211347L4 | Lenti ORF clone of Human S100 calcium binding protein G (S100G), mGFP tagged |
CNY 5,890.00 |
|
| RG211347 | S100G (tGFP-tagged) - Human S100 calcium binding protein G (S100G) |
CNY 2,800.00 |
