GPX5 (NM_003996) Human Untagged Clone

CAT#: SC303416

GPX5 (untagged)-Human glutathione peroxidase 5 (epididymal androgen-related protein) (GPX5), transcript variant 2



  "NM_003996" in other vectors (4)

CNY 1,800.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EGLP; GPx-5; GSHPx-5; HEL-S-75p
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_003996, the custom clone sequence may differ by one or more nucleotides


ATGACTACACAGTTAAGGGTCGTCCATCTGCTTCCCCTTCTCCTAGCCTGCTTTGTGCAAACAAGTCCCA
AGCAGGAGAAGATGAAGATGGATTGCCACAAAGACGAGAAAGGCACCATCTATGACTATGAGGCCATCGC
ACTTAATAAGAATGAATATGTTTCCTTCAAGCAGTATGTGGGCAAGCACATCCTCTTCGTCAACGTGGCC
ACCTACTGTGGTCTGACAGCGCAATATCCTGGTATGTCCGTCCAGGGGGAGGATTTGTACCTAGTTTCCA
GCTTTTTGAGAAAGGGGATGTGA


Restriction Sites Please inquire     
ACCN NM_003996
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003996.2, NP_003987.2
RefSeq Size 1334 bp
RefSeq ORF 303 bp
Locus ID 2880
UniProt ID O75715
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Arachidonic acid metabolism, Glutathione metabolism
Gene Summary This gene belongs to the glutathione peroxidase family. It is specifically expressed in the epididymis in the mammalian male reproductive tract, and is androgen-regulated. Unlike several other characterized glutathione peroxidases, this enzyme is not a selenoprotein, lacking the selenocysteine residue. Thus, it is selenium-independent, and has been proposed to play a role in protecting the membranes of spermatozoa from the damaging effects of lipid peroxidation and/or preventing premature acrosome reaction. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (2) lacks an internal coding exon, which results in a frame-shift, compared to variant 1. The encoded isoform (2) is shorter, with a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...